Clear wheat her from this prediction
Answer:
GENES
"genes contain the information needed to make functional molecules called proteins"
the manual is a gene
the bricks are amino acids
and the structures are proteins
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
They are used for them to adapt to the environment
1) D chromosomes
2) B a double helix
3)A chromosomes are made of DNA
4)A genes
