1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
german
3 years ago
10

Flower color in snapdragons results from the amount of the pigment anthocyanin in the petals. Red flowers are produced by plants

that have full anthocyanin production, and ivory-colored flowers are produced by plants that lack the ability to produce anthocyanin. The allele An1 has full activity in anthocyanin production, and the allele An2 is a null allele. Dr. Ara B. Dopsis, a famous genetic researcher, crosses pure-breeding red snapdragons to pure-breeding ivory snapdragons and produces F1 progeny plants that have pink flowers. He proposes that this outcome is the result of incomplete dominance, and he crosses the F1 to test his hypothesis. What phenotypes does Dr. Dopsis predict will be found in the F2 and why?
Biology
1 answer:
Anna [14]3 years ago
5 0

Answer:

1 offspring will be red in color

1 offspring will be ivory in color

2 offspring will be pink in color

Explanation:

Given -

Allele An1 shows full activity in anthocyanin production and thus are red in color

Allele An2 shows null activity in anthocyanin production and thus are ivory in color

Genotype of pure-breeding red snapdragons is An1An1

Genotype of pure-breeding ivory snapdragons is An2An2

F1 generation -

An1An1 x An2An2

An1An2, An1An2, An1An2, An1An2

F2 Generation -

An1An2 x An1An2

An1An1, An1An2, An1An2, An2An2

The output will be

1 offspring will be red in color

1 offspring will be ivory in color

2 offspring will be pink in color

You might be interested in
Which organelle is used to carry our phototsynthesis?
Darya [45]
I things is golgi apparatus
6 0
3 years ago
Read 2 more answers
Please Help ASAP!!!!!!
VMariaS [17]

I believe the answer you are looking for is A) faster and more efficient development of new hybrids. This is not a step. It is the outcome of the steps.

7 0
4 years ago
Read 2 more answers
Explain Female Reproductive System
WARRIOR [948]
The female reproductive system<span> is made up of seven organs. They are ovary, fallopian tubes, uterus, cervix, and vagina. Basically the main reproductive organ is the ovary</span>
6 0
3 years ago
PLEASE HELP WILL MARK BRAINLIEST
Paul [167]

Answer:

repair the DNA

Explanation:

5 0
3 years ago
Read 2 more answers
Where does dna replication occur
prohojiy [21]

Answer:DNA replication occurs in the cytoplasm of prokaryotes and in the nucleus of eukaryotes.

Explanation: Regardless of where DNA replication occurs, the basic process is the same. The structure of DNA lends itself easily to DNA replication. Each side of the double helix runs in opposite (anti-parallel) directions.

6 0
3 years ago
Read 2 more answers
Other questions:
  • Like all forms of life on earth, all microbial cells perform three major types of activities:
    8·1 answer
  • How do the Earth’s physical factors influence population density? When population growth increases in an area, what is happening
    14·2 answers
  • How does this food chain work, who gets energy from what in order?
    5·2 answers
  • Is the length of shadows at noon higher in summer or winter?
    12·2 answers
  • Which of the following is a negative effect of algal blooms on the environment?
    8·2 answers
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • How are proteins and nucleic acids related?
    11·2 answers
  • List the 3 Parts of the Modern Cell Theory.
    6·1 answer
  • Purple is P and white is p. A pea plant that is pure for purple flowers mates with a pea plant that has white flowers. One of th
    7·1 answer
  • Who designed the labyrinth of king minos in greek mythology?.
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!