1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
hjlf
3 years ago
8

What is unusual about the genetically-inherited mitochondrial disease LHON as compared to the genetically-inherited disease sick

le cell anemia?
Biology
1 answer:
Schach [20]3 years ago
5 0

Answer:

Explanation:

LHON (Leber Hereditary Optic Neuropathy): Is a disease that is characterized by loss of vision in young adults.

Sickle cell anemia: Is a disease characterized by production of abnormally shaped red blood cells, that is, not round in shape as normal but are 'sickle' shaped or elongated/crescent shaped.  

Both diseases are heritable But LHON is caused by mutations existing in the mitochondrion thus only inherited maternally.

Sickle cell anemia is caused by mutations in the HBB gene which produces the beta subunit of hemoglobin. It is inherited from recessive genes of both parents.

You might be interested in
Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
trapecia [35]

Answer:

idk

Explanation:

im very sorry about this but i dont know the answer

7 0
3 years ago
Is the following a hypothesis: temperature will affect the cohesion of water to a penny?
lorasvet [3.4K]
It's not a hypothesis because it's asking a question for example a hypothesis is a statement supported by evidence so for example "my hypothesis would be the temperature does affect the cohesion of water to penny because of this and that"

hope this helps
5 0
3 years ago
Imagine that you move a substance from one container to another and its volume changes. what state of matter is that substance
Marina86 [1]
Gas, researched it. thanks
5 0
3 years ago
How many distinct stages must occur between the point when light first encounters chlorophyll and the point at which
Novay_Z [31]

Explanation:

<u>Three.</u>

Photosynthesis produces glucose and O2 from inorganic CO2, light energy and water.  This occurs in distinct steps: 1) light fixation,  2) electron transport and NADPH production 3)  ATP generation, then 4) carbon fixation and carbohydrate production.

6CO2 + 6H20 + (energy) → C6H12O6 + 6O2

Further Explanation:

Photosynthesis is a chemical process, essential to plant and other primary producers producing energy. As oxygen is emitted, energy in the form of glucose molecules is created from light, water, and carbon dioxide. It happens in several complicated stages, photosynthesis is a speed-limited process, depending on several factors including concentration of carbon dioxide, ambient temperature and light intensity; energy is extracted from photons, i.e. light particles, and water is used as a reduction agent. It occurs in the thykaloids, where pigment molecules live like chlorophyll.

Photosynthesis occurs in several complex steps and is a reaction of a small duration, depending on several fa factors including carbon dioxide concentration, ambient temperature and light intensity; the energy is retrieved from photons, I.e. particles of light, and water is used as a reducing agent. Water supplies the chlorophyll in plant cell with replacement electrons for the ones removed from photosystem II.

Additionally,

  • Water (H2O) divided into H+ and OH-by light during photolysis serves as a source of oxygen along with acting as a reduction agent; it reduces the NADP molecule to NADPH by supplying H+ ions and generates molecules of the energy storage molecule ATP through an electron transport chain.
  • This happens in the thykaloids, where pigment molecules reside like chlorophyll.
  • Later, NADP and NADPH are used in dark reactions during the Calvin cycle, where monosaccharides or sugars such as glucose are produced after several molecules have been modified. These store energy in their bonds which in the mitochondria can be released in respiration.

Learn more about photosynthesis at brainly.com/question/4216541

Learn more about cellular life at brainly.com/question/11259903

#LearnWithBrainly

8 0
3 years ago
Read 2 more answers
What is gene flow and how might it impact a wolf population
mixas84 [53]

Answer:

Gene flow within a population can increase the genetic variation of the population, whereas gene flow between genetically distant populations can reduce the genetic difference between the populations.

Explanation:

3 0
3 years ago
Other questions:
  • One function of the immune system is to attack the foreign cells to protect the body. In organ transplants, the body recognizes
    13·2 answers
  • Which question could be answered using the scientific method? (1 point) Do red or orange flowers attract more butterflies? Do ro
    8·2 answers
  • What observation provides evidence that a cell is most likely a eukaryote
    14·2 answers
  • In a surface wave such as a water wave, particles————
    13·2 answers
  • In the fruit fly, Drosophila melanogaster, a spineless (no wing bristles) female fly is mated to a male that is claret (dark eye
    7·1 answer
  • After settlers migrated to North America, resources were used to establish housing and farm and grazing lands. Which resource wa
    8·2 answers
  • The products of the light reactions of photosynthesis are ______.
    10·1 answer
  • By what mechanism does refrigeration at 4°c slow food spoilage by contaminating microbes?
    11·2 answers
  • Sally has a difficult time understanding language. her words and sentences are not clearly understood and the sentences she does
    6·2 answers
  • What are alleles?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!