1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Fiesta28 [93]
3 years ago
7

The product of two consecutive integers is 72. The equation x(x + 1) = 72 represents the situation, where x represents the small

er integer. Which equation can be factored and solved for the smaller integer?
Mathematics
2 answers:
Marta_Voda [28]3 years ago
8 0
For this case we have the following equation:
 x (x + 1) = 72

 We can rewrite the expression.
 For this, we first make distributive property:
 x ^ 2 + x = 72

 Then, we add -72 on both sides of the equation:
 x ^ 2 + x - 72 = 72 - 72

 Rewriting we have:
 x ^ 2 + x - 72 = 0

 This is the equation that must be factored and solved for the smallest integer.
 Answer:
 
An equation that can be factored and solved for the smaller integer is:
 
x ^ 2 + x - 72 = 0
DochEvi [55]3 years ago
6 0

Answer:

The smallest integer is 8

Step-by-step explanation:

x(x+1)=72

applying distributive law in Right hand side and subtracting 72 from both hand sides we get

x^2+x-72=0

Now we are required to find the factors of 72 , such that their difference is 1. The factors are 8 and 9 and 9-8=1. Hence they satisfies our requirements. Now we split the middle term like

x^2+9x-8x-72=0

taking x and 8 as GCF from brackets

x(x+9)-8(x+9)=0

(x-8)(x+9)=0

Hence  

if (x-8)=0 ; x=8

if  (x+9)=0 ; x=-9

Hence our answer is 8 and 9

You might be interested in
Can someone help me with this question? I flagged the ones i needed help with and yea. This is one of them. Please fill in the b
TEA [102]
P 14 is r=14 and P 16 is r=12
7 0
3 years ago
Express 2.65 as a mixed number in the lowest terms
zmey [24]

Answer:

2 13/20

Step-by-step explanation:

8 0
3 years ago
Read 2 more answers
Why do many animals in grasslands stay together in herds?
mixas84 [53]

Answer:

plz put one qusetion a time plz so i can put it down better

Step-by-step explanation:

4 0
3 years ago
Read 2 more answers
Write the value of the numerator 374 as the product of prime factors
ycow [4]
The prime factors of 374 are 2,11and,17
8 0
3 years ago
What is 824.653 rounded to hundredths place
iren2701 [21]

Answer:

824.65

Step-by-step explanation:

6 0
3 years ago
Read 2 more answers
Other questions:
  • Rewrite in simplest rational exponent form √x • 4√x. Show each step of your process.
    11·1 answer
  • Write the sum or difference in the standard form a + bi.( 3 + 3i) - ( -6 + i)
    9·1 answer
  • Question 5 options: Solve for y in terms of x: 12x−13=3y+b
    12·1 answer
  • PLEASE HELP! THANKS! The measures, in degrees, of the 3 angles of a triangle are given by 2x +1, 3x - 3, and 9x. What is the mea
    8·1 answer
  • Which represents where f(x) = g(x)?
    6·1 answer
  • P and q are points on the line 3y-4x=12<br> Complete the coordinates of p and q
    5·1 answer
  • What is the area in square inches of peace b
    13·1 answer
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • if she could have run 400 meters at the same rate as she ran 100 meters, would she have broken the record? Find the difference b
    8·1 answer
  • What is the slope of the line that passes through the points (7,-6) and (4, -6)?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!