1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
marta [7]
3 years ago
7

Which of the following mechanisms produces the most ATP during cellular respiration?

Biology
1 answer:
STALIN [3.7K]3 years ago
8 0

Answer:

A) oxidative phosphorylation

Explanation:

cellular respiration include glycolysis, pyruvate oxidation, the citric acid or Krebs cycle, and oxidative phosphorylation.

You might be interested in
It is important to understand the differences between chemical and physical changes which process is an example of a physical ch
Bas_tet [7]
A physical change is basically a body change so like if a crayon is solid then sits in the sun for a long time it melts away that’s a physical change because it changes its physical appearance
7 0
3 years ago
Read 2 more answers
What is the original source of energy for all living organisms on earth?
ki77a [65]

Answer:

sunlight

Explanation:

porque yo quiero

7 0
3 years ago
Read 2 more answers
Which is not a source of carbon dioxide gas?
geniusboy [140]
Answer is
C. Plants
3 0
3 years ago
Read 2 more answers
What is the sentence stem cell?
KengaRu [80]

Answer:

Sentences Mobile

Stem cells in embryos generate all other tissues in the body. Opponents say the use of embryonic stem cells would encourage abortions.

Explanation:

Sentences Mobile

Stem cells in embryos generate all other tissues in the body. Opponents say the use of embryonic stem cells would encourage abortions.

3 0
3 years ago
Qué es la ayurveda hindú​
Tanya [424]

Answer:

I'm Indian

Explanation:

but i have no clue what you said

4 0
3 years ago
Other questions:
  • What are limitations in Science? I need this urgently plz helppppp
    12·1 answer
  • Studying the decay of radioactive isotopes in dead organisms helps scientists to identify fossilized remains. The ratio of C-12
    6·1 answer
  • How does a warm-blooded animal get body heat?
    14·2 answers
  • Group name given to the first life forms which developed on earth about 3.8 billion years ago
    10·1 answer
  • ¿que contamina mas?
    15·1 answer
  • Plants preapare their good in their food in their root​
    10·1 answer
  • The process by which the genetic information of the offspring cannot be changed is _.
    12·1 answer
  • A strand of DNA has the sequence GATTACA. what will the sequence of the complementary strand of DNA?
    12·1 answer
  • What is the mRNA in TACCGGATGCCAGATCAAATC?
    5·1 answer
  • Define classification.<br> (In biology)
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!