1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Y_Kistochka [10]
3 years ago
11

What organism is the first step in food chain/web? what organism is normally first step in aquatic food chain/web?\?

Biology
1 answer:
Solnce55 [7]3 years ago
4 0
Producers, such as kelp or seaweed, are always the first step in a food chain/web.
You might be interested in
Although not yet aware of her pregnancy mrs. upton has conceived a single cell from the union of an egg cell and a sperm cell. t
Veseljchak [2.6K]
It's call a zygote cell. 
3 0
3 years ago
Read 2 more answers
An acid is best defined as: Select one:
AveGali [126]

Answer:

A.) a substance with ph between 0 and 7.

Explanation:

as acid has pH value between 0 to 7.

6 0
3 years ago
Read 2 more answers
3 processes of the water cycle<br><br><br>please i really need help this is due on jan 23!!!!! ​
netineya [11]

Answer:

Of the many processes involved in the water cycle, the most important are evaporation, transpiration, condensation, precipitation

Explanation:

8 0
3 years ago
What is the smallest part of an element that retains the properties of the element?
anyanavicka [17]

Answer:atom

Explanation:because it is defined as the smallest form of any given elemental item

6 0
3 years ago
Which part of a sperm cell is responsible for housing the genetic information
babymother [125]
The head at the top, the tail is just for getting to the egg
8 0
3 years ago
Other questions:
  • Consider the diversity of the later Homo species discussed in this lab. Why do you think our direct ancestor survived when the o
    8·1 answer
  • Select the three most prevalent types of healthcare-associated infections.
    12·2 answers
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • The respiratory systems of birds are very efficient at providing oxygen to the blood, which is necessary for birds to expend the
    5·1 answer
  • Which of these is a mixture? A) air B) water C) hydrogen chloride D) carbon dioxide
    10·2 answers
  • A fertilization<br>B prophase II<br>C polyploidy<br>D crossing over​
    10·1 answer
  • Is it possible for individual IV-2 to be a carrier? Why?<br><br> Please help!
    9·1 answer
  • A beetle moving away from a light source is an example of
    6·1 answer
  • Several tissues are classified as connective tissue, what function is common to all types of connective tissue? Prove your answe
    15·1 answer
  • Fill in the blanks correctly: _____________ carbohydrates are more beneficial to the body than ___________ carbohydrates because
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!