1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Bezzdna [24]
3 years ago
6

What challenges do you think parasites face in their survival? How can these challenges affect the parasite?

Biology
1 answer:
Greeley [361]3 years ago
7 0
Parasites need a host. If a host tries to get rid of the parasite or kill it, then the parasite either has to leave the body or die.
You might be interested in
"you are exercising doing aerobics or a stair climber at your fitness center. as you increase to a high intensity of exercise, y
lozanna [386]
You are exercising, doing aerobics or a stair climber at your fitness center. as you increase to a high intensity of exercise, you would expect the tidal volume to increase and the frequency of respiration to increase. 
6 0
3 years ago
Explain the interaction that occurs between a t-helper lymphocyte and a b cell when the b cell is being induced to produce peanu
Paraphin [41]

Answer:

           According to Dr. Ray Schiling (member of the American Academy of Anti-aging medicine) about 1.5 million people suffer from peanut allergies. The seeds of peanut (<em>Arachis hypogea</em>) contain an array of allergens that can induce the production of IgE specific antibodies predisposed individuals. Ara1 and Ara2 are most common seed storage protein that cause allergy. Other allergen proteins such as Ara3 to Ara 17 have also been identified that cause allergy.  


Entry of peanut allergen into body

When peanut allergens enter the body of an individuals it leads to development of different symptoms like itchy skin, tingling sensation, nausea, runny nose and anaphylaxis.  

Allergic response

There are two subsets of T-cells Th1 and Th2. Both invoke different response to allergens. Th1 direct a non-allergic response while Th2 direct allergic response ranging from releasing of histamine to anaphylactic response. The presence of IL-12 cytokines direct a Th1 based, nonspecific response.  


Mechanism of allergic response (interaction between helper T cell and B cell)

Step 1.  

           When allergen enter to body they are encountered by B cells. Immunoglobulin receptors on the surface of B cells recognize antigen (Peanut allergens) and get attached, which are then internalized and processed. Within B cells the fragments of antigens combine with HLA class 2 proteins.  

Step 2

             HLA class 2 with antigen fragments (peanut allergens) then display on the surface of B cells.

Step 3

            Receptors on the surface of helper T cells recognizes the complex of HLA class 2 and antigen fragments (peanut allergen) and is activated to produce cytokines, which activate the B cells.  

Step 4

             B cell is activated by cytokines and begins clonal expansion. Some of the progeny become anti-body producing plasma cells while other become memory B cells.  


7 0
3 years ago
Drag each tile to the correct box
scoundrel [369]
We need the context of the work of you want us to answer
6 0
3 years ago
What are a variety of instruments needed to measure change in the climate system
elena-s [515]

Climate change cannot be measured with a single instruments but require thousands of measuring devices that spread across the globe, land and under the sea. Thus,parameters measured in climate change includes: Rainfall, Sunshine hours, Temperature, Relative humidity, Atmospheric pressure, Wind speed . 

However, there are various instruments used for the measuring of climate change and they can be classified as follows: weather balloons and buoys, thermometers, wind anemometers, Manual rain gauges, transmitting rainfall gauges and Automatic Weather Stations

4 0
3 years ago
Read 2 more answers
The analytical approach to understanding the diversity and relatedness of both extant and extinct organisms is called __________
maxonik [38]

Answer: Systematics

Explanation:

Systematics is the study of diversity of organisms including past and present and relationships among living things. Systematics as analytical approach, help us to understand the diversity and relatedness of both existing and extinct organisms. Systematics is also important in carrying out the conservation issues because, it attempts to explain the biodiversity which is related to different kinds of species and could be used in preservation and protect the endangered animals and plants.

7 0
3 years ago
Other questions:
  • What do cells and organisms have in common?
    12·1 answer
  • stating that an organism is heterozygous is staying its ..... a. genotype... b. phenotype.....c. karyotype....d. test cross
    12·2 answers
  • this is the name applied to the cycle by which ATP are broken down to ADP with the release of energy, and the regeneration of AT
    8·2 answers
  • Adults with more than a twelve (12)-month history of migraines were assigned randomly in a double-blinded study to receive treat
    7·1 answer
  • Please comment the answer, fast!!!!
    15·1 answer
  • Francis Crick stated that information moves from ______ to ______ to ______.
    7·1 answer
  • Please can anyone help me ill make you the brainiest, I need help with these questions!
    15·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • The graph below shows population data for two species.
    10·1 answer
  • Signals from the sense organs are interpreted by the cerebrum, autonomic nervous system, medulla, cerebellum?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!