All categories

3 years ago

What is one of the functions controlled by the cerebellum?

Biology

2 answers:

hram777 [196]3 years ago

8 0

Answer:

Explanation

The cerebellum is the part of the hindbrain of all vertebrates. In humans the cerebellum plays an important role to control and co-ordinate the body.

There are following functions of the cerebellum:

1. Maintaining balance: It exhibit specialized sensors which detects the shift in the balance and movements.

2. Coordinating movements: The cerebellum coordinates the movement of the muscles so that body can perform functions such as walking, running and others.

3. Vision: The cerebellum coordinates the movement of the eyes.

4. Motor learning: The cerebellum plays an important role in learning movements. For example it helps in learning to ride bicycle.

5. Maintenance of posture: The cerebellum coordinate the body to maintain the right posture while standing, walking and during other functions.

Oksanka [162]3 years ago

3 0

The cerebellum receives information from the sensory systems, the spinal cord, and other parts of the brain and then regulates motor movements. The cerebellum coordinates voluntary movements such as posture, balance, coordination, and speech, resulting in smooth and balanced muscular activity.

HOPE THIS WAS HELPFUL! XO

You might be interested in

Why might it be important to the survival of a species that mutations to dna cause changes in organisms?

OlgaM077 [116]

Sometimes the enviornment might change, so the animal has to change with it. It must adapt. That why it can be important

5 0

3 years ago

Scientists use a system called binomial nomenclature to classify organisms. For example, the goldfish is known as Carassius aura

stepan [7]

The correct answer is: d. Carassius is a group of different organisms with similar structures, while auratus is a smaller group of memebers that can only breed with another auratus.

Carassius represents the name of genus. In binomial nomenclature it is the generic name shared by the group of close relatives. In this case, Carassius is a genus in the family of ray-finned fishes.

Auratus represents the species of the fish and it is specific unique epithet within the genus.

3 0

3 years ago

Mucus in the lungs performs a function most similar to:

PtichkaEL [24]

Answer:

saliva in your mouth or mucus in your nose

Explanation:

hope this helped!

brainliest?

7 0

3 years ago

*****!!!! lots of points and brainliest!!!******** how do i find the codon and anti codon? :)

pogonyaev

Answer:

The way to find a codon is by arranging the sequence of nitrogenous bases of the mRNA in groups of three, the triplets. Once the codon is found, the anticodon corresponds to a complementary triplet to that codon.

Explanation:

Codon corresponds to a triplet of mRNA nitrogen bases encoding an amino acid. Anticodon is responsible for carrying amino acids to the ribosome, according to the information of the mRNA, and the sequence of its triple must be complementary to that of the codon mRNA.

If, for example, a codon of the mRNA is AUG, its anticodon of the tRNA must be UAC, that is, complementary. Then, for the indicated exercises:

<u>Exercise 1:</u>

DNA ATACGAAATCGCGATCGCGGCGATTCGG
mRNA UAUGCUUUAGCGCUAGCGCCGCUAAGCC
CODON UAU|GCU|UUA|GCG|CUA|GCG|CCG|CUA|AGC|C-
AntiCODON AUA|CGA|AAU|CGC|GAU|CGC|GGC|GAU|UCG|G-
Amino acid Tyr|Ala|Leu|Ala|Leu|Ala|Pro|Leu|Ser

<u>Exercise 2: </u>

DNA TTTACGGCCATCAGGCAATACTGG
mRNA AAAUGCCGGUAGUCCGUUAUGACC
CODON AAA|UGC|CGG|UAG|UCC|GUU|AUG|ACC
AntiCODON UUU|ACG|GCC|AUC|AGG|CAA|UAC|UGG
Amino acid Lys|Cys|Arg|Stop|Ser|Val|Met|Thr

3 0

3 years ago

Marvin is suffering from the early stages of alzheimer's disease. which component of his working memory is most likely to be aff

olga nikolaevna [1]

Correct answer:
"All of these are equally affected."

When in Alzheimer's disease, all of the working memory is in peril. In early stages of Alzheimer's disease, all of these functions start to have problems. Phonological loop is basically the capacity to memorise speech or information in it. Central executive is the ability to switch attention from one activity to another that is needing more attention. The visuospatial sketch pad is the ability to handle visual and spatial information being able to judge distances for example. All of these are part o the working memory and are affected from the early stages of Alzheimer's disease.

3 0

3 years ago