Ask question

Ask question

All categories

3 years ago

6

Proteins are used for many structural functions such as in the actin and myosin in muscle or as a part of the cytoskeleton scaff

olding that maintains cell shape. What other main function do proteins serve?

1 answer:

Vinil7 [7]3 years ago

6 0

Proteins make up your hair. It is a source of nutrition. They can be used as a ligand in cell communication.

You might be interested in

The process of adiabatic cooling involves

matrenka [14]

Answer:

air masses cooling as they increase in altitude and condense

5 0

3 years ago

BLAST (Basic Local Alignment Search Tool) is a powerful tool for comparing unknown sequences to sequences in online databases. I

storchak [24]

Answer:

This is a well conserved sequence.

Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved

3 0

3 years ago

When you eat salmon for dinner, your digestive system will break down that food

zimovet [89]

Answer: c. Amino Acids

Explanation:

Food is chemically and mechanically broken down into smaller particles like building blocks, the smallest of these are a basic unit called monomers. In the <em>stomach</em>, the enzyme pepsin breaks proteins, like those found in salmon, into smaller peptides by splitting the peptide bonds holding the proteins together. The <em>duodenum</em> processes these newly-formed peptide chains or polypeptides, into smaller ones, through the enzyme action of elastase, trypsin and chymotrypsin; these are produced in the pancreas. Peptidases convert these fragments into amino acid monomers for absorption into the bloodstream via the small intestines.

6 0

3 years ago

Well looking at bacteria under microscope, you decide to take a break. When you return, the amount of bacteria has doubled in si

irinina [24]

I’m unsure how to answer this because I don’t know
How much bacteria there was
What bacteria it was
And what the conditions of the bacteria are
This chart is from Dr. Jason from the math forum
http://mathforum.org/library/drmath/view/64555.html hope this helps!

7 0

3 years ago

Read 2 more answers

What cell organelle can be seen changing position in the moving cytoplasm of elodea?

Tom [10]

<span>Once the cytoplasm of the amoeba is moving, all the cells in the said cytoplasm will move as well. Consequently all the cell organelles can be seen changing positions. The cytoplasmâ€™s ability to move is dependent on the entire composition of cell organelles that make up the said cytoplasm.</span>

3 0

3 years ago