This is a plant cell and belongs to the plant kingdom
Epigenetics is the study of how the structure and function of genes interact with our environment to influence behavior.
In addition to your surroundings and habits, such as what you eat and how much exercise you get, your genes play a significant part in determining your health. The field of epigenetics investigates how environmental factors and behavior may alter how your genes function. Gene-environment interactions that result in the expression of different phenotypes throughout development are the basis for the initial usage of the term "epigenetics." To turn on or off the genes that cause long-lasting alterations linked to the differentiation of various cell types, epigenetic processes are frequently used.
Epigenetics is the study of how DNA sequences are maintained as genes are controlled by cells. DNA alterations known as epigenetic changes control whether or not genes are activated.
Learn to know more about Genes on
brainly.com/question/3764946
#SPJ4
Answer:
Sunlight and water.
Explanation:
The sun is the plant's most important nutrient. Plants convert sunlight into sugars in order to grow. Water is needed in two ways, it serves as both a solvent for mineral salts that are carried inside plant cells, and it is an essential component of photosynthesis. The questioner might have asked "name one" so they don't have enough information to answer with any greater certainty - but the answer remains the same regardless of how many nutrients they ask about.
Minerals are also required by plants in order to function properly including calcium, potassium, iron, magnesium just to name a few minerals which are found in healthy nutritious produce!
Answer:
d. T
Explanation:
For a given DNA sequence, the array is represented as:
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.
i.e.
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
*AGTGTCCAGG
Thus, the first nucleotide that will be incorporated into the DNA will be T