1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
OverLord2011 [107]
3 years ago
7

Create a Venn diagram comparing prokaryote and eukaryote cellsplz help

Biology
1 answer:
GuDViN [60]3 years ago
6 0
Prokaryotes: the simplest and oldest form of life, single celled, start of live/where all life came from, they can live in any environment on Earth, bacteria are the only prokaryotes. They DO NOT have a nucleus. Tails help them move along with little hairs around the cell. No organelles, they have circular chromosomes, they're unicellular or colonial, they have a cell wall and cell membrane.

Eukaryotes: Have a nucleus as well as organelles, linear chromosomes, have a cell wall (plants&fungus), have a cell membrane.

Hope I was able to help! :)
You might be interested in
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
2 years ago
In a scientific experiment, the_ change in respond to anther change.
Arturiano [62]
That’s a dependable variable because it’s relying on something else.
5 0
3 years ago
Read 2 more answers
A food that is high in calories and could be used for energy storage in animals is MOST LIKELY high in
FinnZ [79.3K]

Hello Mr. Chase

the answer would be lipids.

6 0
3 years ago
Read 2 more answers
How does distance from the epicenter of an earthquake change the earthquake's effects?
nadezda [96]
The strongest part in an earthquake is the epicenter so it would be option A :)
6 0
3 years ago
Why does hand washing decrease infectious disease transmission?
galina1969 [7]
Letter C.. Hand washing prevents germs spreading from another
6 0
3 years ago
Read 2 more answers
Other questions:
  • The main goal of cellular respiration is the production of molecules.? A) ADP
    7·1 answer
  • Explain the main idea of the article in detail.
    15·2 answers
  • The layer of the epidermis that contains several layers of living cells connected by abundant desmosomes is the stratum The laye
    11·1 answer
  • When an animal cell is placed in a hypotonic solution it will
    5·2 answers
  • Around how long is the longest fragment of baby guppy DNA?​
    6·2 answers
  • What would happen if there were no decomposers in a food web?
    15·2 answers
  • A well designed experiment _____.
    5·2 answers
  • Damage to what structure may result in a heart murmur?
    15·1 answer
  • Which group consists entirely of organic molecules
    7·1 answer
  • An ice is put in a beaker and left in the sun for long<br>What with happen to the iceblock?<br>​
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!