1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tankabanditka [31]
3 years ago
13

If a person has a diet high in saturated fats, _________ molecules can carry cholesterol from the liver to cells and to the arte

rial walls whereas __________ transports cholesterol from the cells to the liver where it is converted to bile salts which can modulate cardiovascular function.
Biology
1 answer:
leonid [27]3 years ago
4 0

Answer:

If a person has a diet high in saturated fats, LDL cholesterol molecules can carry cholesterol from the liver to cells and to the arterial walls whereas HDL cholesterol transports cholesterol from the cells to the liver where it is converted to bile salts which can modulate cardiovascular function.

Explanation:

Cholesterol is a lipid generated in the liver that is used to make hormones and vitamin D, but can also be ingested when eating fats.

Cholesterol can be divided into two types: LDL (low-density lipoprotein) and HDL (high-density lipoprotein).

LDL is commonly known as the "bad cholesterol" and is responsible for the deposit of cholesterol in the walls of arteries, which generates atherosclerosis and can potentially lead to strokes or heart attacks because it occludes the vessels and makes it impossible for the blood to advance.

HDL is also called "good cholesterol" because it takes the cholesterol from the cells to the liver where it'll serve a good cause, instead of blocking the arteries.

To reduce the amount of LDL, it's best to limit the consumption of fatty meats, dairy products and other saturated fats. Foods with a good amount of HDL are those with unsaturated fats, like fish, nuts and seeds.

You might be interested in
Why do leaves on trees appear to be green?
kobusy [5.1K]
They appear to be green because of the chloroplast in the cells.
4 0
3 years ago
The pathway of energy transfer through various stages as a result of the feeding patterns of a series of organisms is called the
ch4aika [34]
This might help: 
https://quizlet.com/1965478/environmental-health-test-1-flash-cards/ 
7 0
3 years ago
What does reverse transcriptase use to form dna apex?
Marianna [84]

Reverse transcriptase use mRNA to form DNA apex

Reverse transcriptase is a broad family of enzymes that play a unique role in the flow of genetic information. The synthesis of DNA from an RNA template through reverse transcription produces complementary DNA. Reverse transcriptase use an RNA template and a short primer complementary to the 3' end of the RNA to direct the synthesis of the first strand complementary DNA, which can be used directly as a template for the Polymerase Chain Reaction.






7 0
3 years ago
Read 2 more answers
What property of a corridor's design is most important, allowing it to maximize<br> biodiversity?
Romashka-Z-Leto [24]

Answer:

The ability to maintain vegetation?

Explanation:

7 0
3 years ago
Which of the following characteristics of plants is absent in their closest relatives, the charophyte algae?
Phoenix [80]

Answer: d. alternation of multicellular generations

Explanation:

The gametophytic as well as the sporophytic generations are alternative in the life cycle of the multicellular plants. This can be seen among the land plants. This feature cannot be seen in the algal species as they are unicellular in nature. Thus cannot be seen in the relatives of charophyta algae.

3 0
3 years ago
Other questions:
  • Question 1
    15·1 answer
  • Young multicelled organisms usually start out small, then grow in size and increase in complexity. this process is called
    10·1 answer
  • Survival of the fittest
    12·1 answer
  • The ____________ is considered the autonomic control center of the body due to its regulation of hormone secretion, thermoregula
    5·1 answer
  • Which observation of dihybrid crosses led to Mendel’s law of independent assortment? * 1 point Similar traits are always inherit
    9·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • Which type of organism is used to make bread rise when baking?
    13·1 answer
  • What hormone is produced by beta cells of the pancreas?<br> T3<br> glucagon<br> insulin<br> T4
    8·1 answer
  • Can you help me with biology?
    6·1 answer
  • Which phylum of fungi contains the bracket-type of fungi that is found on the sides of trees?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!