1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Delicious77 [7]
3 years ago
7

What is the first thing to occur in dna replication?

Biology
1 answer:
12345 [234]3 years ago
4 0
The first thing is that the enzyme, DNA helicase
breaks the hydrogen bonds to unzip the double strand of dna for replication to take place
You might be interested in
Some species of hares are brown most of the year, but change color to white in the winter. This allows them to
den301095 [7]

Answer:

its A

Explanation:

5 0
3 years ago
Sperm are the only human cells to have _____.
vlada-n [284]
Sperms are the only human cell to have flagella
6 0
3 years ago
Can bacteria be viewed with a light microscope?
yawa3891 [41]
Yes it can but there are some issues to using a light microscope such as they are transparent so it’s best to use a prepared slide which has been stained.
7 0
3 years ago
Read 2 more answers
Which of these phrases BEST describes atoms?
Eva8 [605]
The answer is ..b .the smallest units of an element ...

Hope it helps !!!
7 0
3 years ago
Which of these statements is false? Veins always carry blood toward the heart. Veins can carry oxygen-rich blood. Arteries alway
Alex73 [517]

Answer:

Arteries never carry oxygen rich blood

Explanation:

This is totally wrong as most Arteries carry oxygenated blood away from.the heart to other organs and structures. Only the pulmonary artery carries deoxygenated blood to the lungs for oxygenation

7 0
3 years ago
Other questions:
  • What is a plasmid? How is a plasmid used in gene splicing?
    9·2 answers
  • In which phase of meiosis 1 do homologues separate?
    6·1 answer
  • Veins have a much lower blood pressure than arteries. Which of these prevents backflow of blood in veins?
    13·2 answers
  • What does Genetic drift do?
    7·1 answer
  • The right side of the heart is considered the systemic circuit pump. The right side of the heart is considered the systemic circ
    6·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • What increases the number of tissues in an embryo?
    9·1 answer
  • Creep is a type of erosion caused by
    12·1 answer
  • The second male cone in cycas plant is formed by the activity of​
    14·1 answer
  • What is a gene? Choose the definition that best matches the term Gene.
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!