1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
alexdok [17]
3 years ago
10

Which of the following steps is an important part of the process by which ecology guides humans to a sustainable future?

Biology
2 answers:
Helen [10]3 years ago
8 0
The step that is an important part of the process by which ecology guides humans to a sustainable future is that behavior is changed after the cause of the problem is identified. The correct answer is D.
kondaur [170]3 years ago
5 0
It will be D. behavior is changed after the cause of the problem <span />
You might be interested in
Identify the organelles in the cell to the right.<br> A<br> B<br> C<br> D<br> E<br> F
serg [7]

Answer:

A=Vacuole

B=chloroplasts

C= cell membrane

D= endoplasmic reticulum

E= nuclear envelope / or nucleus in general

F= The cell wall.

6 0
3 years ago
I have mutant cells that make no pfk2enzyme. i measure rates of oxygen consumption in these mutant cells and compare them to wil
Kazeer [188]

The correct answer is that mutant cells will exhibit diminished oxygen consumption; decreased glycolysis results in decreased Kreb's cycle and electron transport chain.

The PFK2 enzyme catalyzes the generation of F26BP, this binds with the allosteric site of PFK-1 and increases the affinity of PFK-1 with F6P and also decreases the affinity of allosteric inhibitors citrate and ATP to PFK-1. Thus, PFK-1 will combine with F6P at a greater rate.

This ultimately results in more glycolysis, thus, more ETC and more consumption of O2. If there is no PFK2, then there will be a reduction in glycolysis, TCA, ETC, and consumption of oxygen.

The PFK2 is an enzyme accountable for monitoring the rates of gluconeogenesis and glycolysis in the human body. In the absence of glycolysis, there will be a reduction in TCA, ETC, and consumption of O2.

5 0
3 years ago
During the 1900s, the following genetic discoveries were made:
Paha777 [63]

Answer:

There are four bases in DNA, and they combine in a specific way. Adenine pairs with thymine, and guanine pairs with cytosine.

Explanation:

6 0
2 years ago
4. Which of the following is NOT an inherited trait?
Goryan [66]
D. Ability to read

Hope this helped
4 0
2 years ago
Read 2 more answers
Proteins that speed up the rate of chemical reactions in the cell without requiring high temperatures are antibodies.
Ymorist [56]
This is false. The Enzymes are proteins that speed up the rate of chemical reactions in the cell without requiring high temperature. Antibodies are proteins which react to alien or unknown organisms that enter our body like bacteria and viruses.

I hope it helps, Regards.     <span> </span>
6 0
3 years ago
Read 2 more answers
Other questions:
  • Both the sympathetic and parasympathetic divisions can be found in the __________ nervous system. A. central B. autonomic C. som
    5·2 answers
  • What is a small segment of dna that contains the information to buildings a protein
    13·1 answer
  • During which process are food molecules broken down to produce chemical potential energy in the form of atp
    13·1 answer
  • What are the 3 patterns of surface processes
    7·2 answers
  • Listen
    5·1 answer
  • Sam drives an excavator at an open surface strip coal mine. Which type of coal is he most likely to collect closest to the surfa
    9·1 answer
  • Part A
    9·1 answer
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • If the Whole Brainers of 1850 could see an fMRI, would it support or contradict their theory? Include evidence from both texts t
    14·2 answers
  • Please help! Will give brainliest if it’s the correct answer
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!