<span>There are two concerns. First, that the turkey meat not spoil, for which it is recommended that a cooler with ice be available to keep the meat at a safe temperature. Second, that the person carrying the turkey is safe, for which the individual should use care with knives and gloves.</span>
D the expansion of their territory
Answer:
d. T
Explanation:
For a given DNA sequence, the array is represented as:
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.
i.e.
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
*AGTGTCCAGG
Thus, the first nucleotide that will be incorporated into the DNA will be T
Answer:
Ca(OH)2 (aq)
Explanation:
The balanced neutralization reaction i.e. a reaction between an acid and a base, in this question is given as follows:
H2SO4(aq) + Ca(OH)2(aq) → CaSO4(aq) + 2H2O(l)
According to Arrhenius in his definition of acid and base, a base is a substance that dissociates into hydroxide ions (OH-) when in an aqueous solution. In other words, a base increases the concentration of hydroxide ions when dissolved.
In this reaction, Ca(OH)2 releases the OH- (hydroxide ion) that combines with the hydrogen ion (H+) released by the acid, H2SO4, to form water (H2O). Hence, Ca(OH)2 (aq) is the BASE.
Answer:
I think the answer us sulfuric acid
