1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
shutvik [7]
3 years ago
10

What types of specimens were you able to view under each of the microscopes in the microscope activity? How did the specimen vie

ws differ?
Biology
2 answers:
natali 33 [55]3 years ago
8 0
The 40,100, and 400 are at different magnification.  i need pictures or something.
bazaltina [42]3 years ago
6 0
An electron microscope is very powerful and allows you to see very tiny, thin specimens. The question makes it seem that you looked through both types of microscopes at specific samples? As for how they would differ, a light microscope's level of magnification is limited by the physical characteristics of light and therefore can only see objects as small as organelles inside of a cell. A scanning electron microscope, however, does not use light, it uses a beam of electrons to visualize the sample. Electrons are much smaller than the light beam and are able to image much smaller objects, such as molecules and atoms.
You might be interested in
Photosynthesis is a complex set of chemical reactions in which light energy is converted in to______________________ energy.
zhuklara [117]

Answer:

chemical energy

4 0
3 years ago
Aerobic respiration is (1 point)
Anestetic [448]

<u>Answer</u>

Aerobic respiration is:

B) an efficient cellular respiration process that produces large amounts of energy.

8 0
3 years ago
What is the answer for this plz????
Artemon [7]

Answer:

Alkali metals are any of the elements found in Group IA of the periodic table (the first column). Alkali metals are very reactive chemical species that readily lose their one valence electron to form ionic compounds with nonmetals. All elements in the alkali metal group occur in nature.

Explanation:

8 0
3 years ago
Read 2 more answers
What happens to an enzyme as the temperature rises
Damm [24]

heightened temperatures can cause enzymes to work more quickly whereas if the temperature gets too high the enzyme stops working, If the temperature around an enzyme gets too high, the enzyme loses its shape, which is known as denaturation, and will eventually stop working

6 0
4 years ago
What would MOST LIKELY happen to the black swallowtail butterfly if these plants continue to decrease?
Paul [167]

Answer:Limiting factor is a factor which can limit the abundance, distribution of the species in an ecosystem this can be a resource, predator or natural disaster. The black swallowtail butterfly feeds on endangered plant named Candy's dropwort. If the plants continue to decrease the population of black swallowtail butterly will also decrease as decrease in the plant population will act as a limiting factor for the growth of butterfly population.

Explanation:

8 0
3 years ago
Other questions:
  • Which statement is true about BRCA1 and BRCA2 genes?
    14·1 answer
  • How long will it take a howler monkey call to get to another howler monkey if they were 2 km apart
    9·1 answer
  • What organism produces about half of the oxygen on earth?
    6·1 answer
  • Which of these was NOT characteristic of the first cells on Earth?
    10·2 answers
  • Explain the difference in results for the inheritance of the wing and fire-breathing genes vs. the inheritance of the wing and h
    10·2 answers
  • Four children of a man and woman who are second cousins have too few teeth, which is an autosomal recessive condition called oli
    14·1 answer
  • Help me pleasssssseeee!
    14·2 answers
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • Study of structure, physiology, biochemistry development, evolution, genetics of a cell is called..
    11·1 answer
  • PLEASE HELP ASAP<br><br> how does the ribosome read the mRNA?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!