1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
melisa1 [442]
2 years ago
7

PLEASE HELP ASAP how does the ribosome read the mRNA?

Biology
1 answer:
ValentinkaMS [17]2 years ago
8 0

Answer:

A ribosome is made up of two basic pieces: a large and a small subunit. During translation, the two subunits come together around a mRNA molecule, forming a complete ribosome. The ribosome moves forward on the mRNA, codon by codon, as it is read and translated into a polypeptide (protein chain).

Explanation:

You might be interested in
What other factors might limit human population growth?
REY [17]

Answer:

joe biden

Explanation:

hes making people lose brain cells every time he talks/stutters

4 0
3 years ago
1. Fresh lava traps the direction of the earth's magnetic pole as it hardens.
melomori [17]
<span>1. As lava cools, it begins to go in the magnetic direction of the pole. It actually has been able to show magnetic pole changes throughout history this way. 2. The youngest rocks, crust, and fossils are near the ridge. 3. True, and this is essential for the theory of plate tectonics to work.</span>
6 0
3 years ago
What serves as a structure in a cell?
Sunny_sXe [5.5K]

Answer:

The cell membrane, or in plant cells, the cell wall

Explanation:

In a plant cell the cell wall helps maintain structure, and in animal cells, the cell membrane regulates what goes in and out of the cell and acts as a structure

8 0
3 years ago
The difference between the cellular make-up of a living organism and an aluminum cari is the ___
Orlov [11]

Answer:

The difference between the cellular make - up of a living organism and aluminum can is the ability to use energy .

6 0
3 years ago
10 branches of science first is definition of science
creativ13 [48]

Answer:

ham Bhan k Uthai xeya ta hamra Garmin lagai xa kathi la Kani k bara ma Pharo thanda lagai xai

7 0
1 year ago
Other questions:
  • Wendy has been doing some undergraduate research in Professor Thomas's biology lab. While riding her bike home late one evening,
    5·1 answer
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • 2. The instructions for the traits of an organism are determined by
    10·2 answers
  • Research suggests that deficiency of vitamin d may lead to:
    5·2 answers
  • Please help. Quick and tiny question. :]
    15·2 answers
  • A good posture is one that places the least amount of ___ on your muscles and joints
    5·2 answers
  • I need help ASAP
    9·1 answer
  • PLZ HEEEEELP NOWWWWWW
    14·1 answer
  • If a DNA code was T-G-G-A-C, what would be the RNA code that matched the DNA?
    9·1 answer
  • List the abiotic and the biotic factors in the following image.
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!