1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kogti [31]
3 years ago
8

WILL PICK BRAINLIEST!!

Biology
1 answer:
Lady_Fox [76]3 years ago
7 0
I think C would be correct
You might be interested in
The offspring of two parents obtains a single copy of every gene from each parent.<br>True or False
Sauron [17]

Answer:

true

Explanation:

7 0
3 years ago
Read 2 more answers
Enter the sequence of the DNA coding strand with a 5-3 polarity. DO NOT WRITE 5 OR 3 OR 5' OR 3' IN THE BOX!
Charra [1.4K]

Complete question:

Use the sequence below to answer the following questions  

3’-ACGGATCCTCCCTAGTGCGTAATACG-5’  

5’-TGCCTAGGAGGGATCACGCATTATGC-3’  

1. Enter the sequence of the coding strand with a 5’-3’ polarity

Answer:

coding strand → 5´- GCATAATGCGTGATCCCTAGGCA -3´

Explanation:

When referring to the <u>coding strand</u>, we are talking about the sequence that turns to be the same as the mRNA that results from the transcription of the same DNI segment -switching bases T for U-.  

The coding strand receives that name because it is the sequence that codes for each amino acid composing the proteins.

When the DNI molecule separates into two strands to form the transcription bubble, we can identify two separate segments: coding strand and template strand.  

The coding strand goes in direction 5´ to 3´, while the complementary strand -template strand- grows in direction 3´ to 5´.  

Whenever we have a DNI molecule and we need to determine which strand is the coding one, we just need to look for the presence/absence of start or stop codons.

So, in the exposed example we have two strands, but we do not know yet which one is the coding one.

Conventionally, the first strand is always the coding one. However, let us analyze it by using the presence/absence of codons.

First-strand:

3’-ACGGATCCTCCCTAGTGCGTAATACG-5’

let us write it is 5´to 3´direction

5´- GCATAATGCGTGATCCCTAGGCA -3´

now let us identify the start and stop codons in 5´⇒3´direction.

  • Start codon ⇒ ATG
  • Stop codon ⇒ TAA, TAG, TGA

5´- GCATA<u>ATG</u>CGTGATCCCTAGGCA -3´ ⇒ 1 start codon at the beginning

5´- GCA<u>TAA</u>TGCG<u>TGA</u>TCCC<u>TAG</u>GCA -3´ ⇒ 3 Stop codons

Second strand: We will do exactly the same procedure

5’-TGCCTAGGAGGGATCACGCATT<u>ATG</u>C-3’⇒ 1 start codon near the end

5’-TGCC<u>TAG</u>GAGGGATCACGCATTATGC-3’⇒ 1 stop codon at the beginning

What we did here was to identify in both provided strands, where the start and stop codons are placed. We can see that in the first strand we have the start codon near the beginning, while in the second strand we have it near the end of the sequence. From this information, we can assume that the first strand is the coding one. <em>However, you need to know that some coding sequences do not have start and stop sequences, because they might correspond to a sequence in the middle of a gene.</em>

So, the sequence of the DNA coding strand with a 5-3 polarity is

5´- GCATAATGCGTGATCCCTAGGCA -3´

8 0
3 years ago
Which is a way for the body to conserve water during periods of heavy sweating?
Diano4ka-milaya [45]
It can filter less water out of the blood.!
4 0
3 years ago
Which system regulates and controls growth, development, and metabolism
Ilya [14]
The endocrine system through the use of hormones
7 0
3 years ago
Read 2 more answers
critically evaluate the role of a persons rights and responsibilities when executing freedom of expression during verbal interpe
Stells [14]

A person does have basic human rights and one is the freedom of expression. Though this is the case, we should understand that our right to freely express ourselves (from political to religious views), it does not necessarily give us the right to impede another person’s. A play with words can easily hurt or even harass other people, and in return may be a form of human right violation. 

3 0
3 years ago
Other questions:
  • Mosquitoes can often transmit viruses from one organism to another, acting as _______ of the virus. 
    15·2 answers
  • Which enzyme is not working correctly if the dna had more than nomal level of mutations?
    8·1 answer
  • A hawk has a genetic trait that gives it much better eyesight than other hawks of the same species in the same area. Explain how
    10·1 answer
  • Mutations can occur in the chromosomes of all types of cells. Mutations that are passed on to offspring must occur in A) gametes
    7·2 answers
  • .... Weak attraction
    8·1 answer
  • Why do we get ill when we get stressed?
    13·1 answer
  • Match the sphere with its correct statement.
    5·2 answers
  • Explain why adding protons to the treated mitochondria increase ATP synthesis?​
    9·1 answer
  • When the cell is preparing to divide, DNA replicates and begins to coil around itself and around ______________.
    14·1 answer
  • An organism that has two different alleles for a trait
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!