1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
djyliett [7]
3 years ago
16

Which best matches the plant tissue to its function

Biology
1 answer:
Gennadij [26K]3 years ago
4 0
Vascular tissue transport materials from the environment into the plant.
You might be interested in
What allowed invasive species such as cane toads and camels to be so successful in Australia?
Mars2501 [29]

Answer:I'm almost positive the answer is A

Explanation:

7 0
3 years ago
A factory located near the top of a hill leaks chemicals into the groundwater. How could this leakage affect the groundwater at
dybincka [34]

Answer:

Explanation: ground water contamination is nearly

always the result of human activity. In

areas where population density is high and human

use of the land is intensive, ground water is especially vulnerable. Virtually any activity whereby

chemicals or wastes may be released to the environment, either intentionally or accidentally, has

the potential to pollute ground water. When

ground water becomes contaminated, it is difficult

and expensive to clean up.

To begin to address pollution prevention or remediation, we must understand how surface waters

and ground waters interrelate.

8 0
3 years ago
Please answer honestly. BRainliest and help ASAP please!!!! question 38:
kaheart [24]

Answer:

4

Explanation:

A simple trick for finding the number of offspring in a generation is counting the number of lines coming from the bar underneath that generation. A and B produced C, E, F, and H.

4 0
2 years ago
Which of the following statements about tuberculosis is FALSE?
german
A. It usually affects the digestive tract. is false. This is because although tuberculosis can affect it, most of the time it affects the lungs and respiratory system.
Hope that helped you.
5 0
4 years ago
Fossil fuels, like the gas we put into our<br> cars, comes from:
Korvikt [17]
The answer would be c, fossil fuel comes from the decaying fossils underneath the ground from millions of years ago.
4 0
3 years ago
Other questions:
  • HELP!! Best answer gets Brainiest!
    5·1 answer
  • Hydrogen and Oxygen will have properties after they bond to become water. A. the same B. both of their original C. completely ne
    6·1 answer
  • According to Newton's third law, for every action, there is an equal and opposite
    9·1 answer
  • How are self-replicating molecules, such as RNA molecules in the “RNA World” hypothesis, essential to the most popular hypothese
    14·2 answers
  • Can someone please explain what gives air its weight?
    8·1 answer
  • what is the advantage of timing over a shorter period of time especially when you have just finished exercising
    5·1 answer
  • Base Sequence of Complementary DNA Strands One strand of a double-helical DNA has the sequence (59)GCGCAATATTTCTCAAAATATTGCGC(39
    6·1 answer
  • Why is a natural ecosystem a open and closed system
    5·1 answer
  • What do similarities in DNA, proteins, and amino acids show about relatedness of species
    14·2 answers
  • What would happen if new cells were larger than the original cell?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!