1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Natasha2012 [34]
3 years ago
9

Once a hypothesis is tested and confirmed, and then tested again and confirmed again by many others, it may provide the basis fo

r, or become a art of, a
Biology
1 answer:
Lemur [1.5K]3 years ago
5 0

Answer:

theory

Explanation:

a theory results from a proven hypothesis

You might be interested in
How many population(s) can have the same species name
SIZIF [17.4K]

Answer:

A population is all the organisms that both belong to the same species and live in the same geographical area. A species is defined as a group of organisms capable of interbreeding and producing fertile offspring. There can be multiple populations of one species but a population only consist of one species.

Explanation:

3 0
4 years ago
A hammer can be used to see how a mineral breaks. If you observe square chunks of the mineral when broken, what can you conclude
love history [14]

c. the mineral has cleavage

8 0
3 years ago
Read 2 more answers
John wants to cook some macaroni and cheese, so he puts a pot of water on to boil. However, John notices that it is taking a lon
Lubov Fominskaja [6]

The correct answer is  

B. Water has a high specific heat.

Water specific heat or specific heat capacity represents the quantity of heat that is necessary to increase the temperature of a 1° Celsius per unit of mass of 1 kg of water.


7 0
3 years ago
“Dear Basketball" by Kobe Bryant Analysis
Firdavs [7]

Answer:

He describes basketball as asking him for his “hustle.” Instead, he gave the sport his heart. The speaker worked hard because he wanted to do the game justice. He wanted to show his love for the sport because that's “what you do / When someone makes you feel as / Alive” as basketball made him feel.

6 0
3 years ago
transcribe this strand of DNA 5' 3’ TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid-
tino4ka555 [31]

Answer:

AUGCGCGUAAAGCGGUACUUCUGUAAAUAAGACGAAGAG

Explanation:

this is the complementary strand for the mRNA.

A=U

C=G

G=C

T=A

this is the key for any mRNA strand.

;)

3 0
3 years ago
Other questions:
  • Explain why scientists believe the Abert’s and Kaibab squirrels are examples of speciation.
    10·2 answers
  • Why is the average annual high temperature in Cape Hatteras, NC higher than the average annual high temperature in Monterey, CA?
    12·2 answers
  • Bacteria grow best in food that has a pH factor that is _____.
    12·1 answer
  • The current eccentricity of Earth is .017. The shape of the Earth's orbit changes from being elliptical (high eccentricity) to b
    5·2 answers
  • Does pulmonary blood pressure increase or decrease with left-sided heart failure? Explain.
    5·1 answer
  • A subcontinent is __________. A. a large landmass that is part of a continent B. a large area of land that is below sea level C.
    11·2 answers
  • When a nerve impulse reaches the end of an axon, the neurons release ________________, chemicals that carries the signal across
    6·2 answers
  • 28. Flowers are derived evolutionary from modified __________________.
    8·1 answer
  • Is a non living organisms can grow?
    10·1 answer
  • How many breaths per minute is normal for an infant?.
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!