1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Len [333]
3 years ago
14

In an animal cell , how is the DNA from the organelle inherited ?

Biology
2 answers:
Lady_Fox [76]3 years ago
8 0

Answer:

the answer is A

Explanation:

mylen [45]3 years ago
4 0
I think the answer is B sorry if I’m wrong
You might be interested in
Cystathioninuria can be caused by two different mutations in the enzyme cystathionase. Cystathioninuria caused by mutation 1 can
polet [3.4K]

Answer:

C. The enzyme with mutation 1 has decreased affinity for pyridoxal phosphate, whereas the enzyme with mutation 2 has lost the ability to bind to the substrates.

Explanation:

A coenzyme is an organic cofactor that binds with an enzyme in order to initiate or aid the function of the enzyme. A coenzyme binds to the active site of the enzyme (where the reaction occurs), thereby triggering its activation by modifying protein structure during the reaction. Some examples of coenzymes include Coenzyme A and Adenosine triphosphate (ATP). Pyridoxal phosphate is a coenzyme (it is the active form of vitamin B6) that is required for the function of cystathionase. Moreover, cystathionase is an enzyme that enables cells the synthesis of cysteine from methionine (transsulfuration pathway). The binding of pyridoxal phosphate to the enzyme increases the binding affinity of the enzyme for the substrate, thereby influencing its activity. In this case, it is expected that mutation 1 reduces the binding affinity of the enzyme to the cofactor, and thereby the cofactor is required at a higher concentration to restore normal enzyme activity.

3 0
3 years ago
The failure of sister chromatids to separate properly during cell division
Vinvika [58]

Answer:

huh? wait..what?

Explanation:

6 0
3 years ago
Why is it difficult to avoid a tsunami?
Gelneren [198K]

Answer:

It is difficult to avoid a tsunami due to it being such a large volume of water that is capable of destroying a large amount of land.

Explanation:

However, even though it is difficult to avoid a tsunami, as they are extremely difficult to predict, there are ways where one can begin to prepare before it hits. One of the ways you can do this is getting to a higher ground far away from inland, avoiding downed power lines, and steering clear of buildings or bridges where large, heavy objects could fall during an aftershock.

Tsunamis are incredibly dangerous, since there is a great chance that if you get caught in one, you can drown. Since tsunamis have little to no warning when they arrive, it is always essential to be prepared when one strikes.

I hope this helped! :)

7 0
3 years ago
Why do some types of packaging need to be prepared before putting it in the bin?
zimovet [89]

Answer:

to prevent the spreading of germs

Explanation:

5 0
3 years ago
Three forms of RNA help build proteins inside cells. Select the number that corresponds to messenger RNA?
timurjin [86]

The number 1 correspond to messenger RNA.

3 0
3 years ago
Other questions:
  • Describe two applications of transgenic organisms
    15·2 answers
  • Which bone(s) of the human body differ in males and females? label one with a?
    7·1 answer
  • What is the difference between RNA and DNA
    13·1 answer
  • Smooth muscle cells lack which protein(s)?
    11·1 answer
  • Which 2 compositions of water move within a deep water current?
    7·1 answer
  • You have 46 chromosomes in each of your somatic cells. If you cut your arm, how many chromosomes would be in each newly formed s
    9·1 answer
  • Because of hemoglobin, blood is able to carry ____ times more oxygen than what can dissolve in the blood.​
    11·1 answer
  • What is the mRNA in TACCGGATGCCAGATCAAATC?
    5·1 answer
  • CAN SOMEONE ANSWER QUESTIONS 22-28 PLZ!!!!!!!!!!!!!
    6·1 answer
  • Help me with this I willl mark you brainlyest I got test due
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!