1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sergiy2304 [10]
3 years ago
8

What is the correct order of steps in the scientific method?

Biology
2 answers:
Darya [45]3 years ago
7 0

Answer:

B.Ask a question ,make a hypothesis, test the hypothesis, analyze

jok3333 [9.3K]3 years ago
6 0

Answer:

B. Ask a question, make a hypothesis, test the hypothesis, analyze

results, and draw conclusions.

Explanation:

You might be interested in
Carrot turnip radish sweet potato odd one
maw [93]
Beets, carrots, turnips, onions, radishes, and (the odd one out) celeriac.
3 0
3 years ago
Read 2 more answers
Help me ASAP please
Westkost [7]

Answer:

C

Explanation:

5 0
3 years ago
A commonly prescribed benzodiazepine for sleep, which is also used to sedate patients receiving dental implants is valium halcio
balu736 [363]
<span>The answer to this is Halcion which is medical treatment given to patients with sleeping disorders such as insomnia. It helps you fall asleep faster and for a longer period of time.</span>
6 0
3 years ago
N important organelle found in eukaryotic cells produces ribosomal subunits from proteins and ribosomal rna, also known as rrna.
Fofino [41]
It's the nucleus or the nucleolus to be exact which produces rRNA which as a structural component of ribosomes.

Hope i helped!
5 0
4 years ago
Read 2 more answers
Which statement is most likely to apply to a cell that has DNA within its cytoplasm?rokaryotic cell?
PolarNik [594]

Answer:

1ST ONE

Explanation:

7 0
3 years ago
Other questions:
  • Using the 10 percent rule, explain why there is typically smaller populations of quaternary consumers compared to primary consum
    13·1 answer
  • Tyrosine and tryptophan are less hydrophobic than phenylalanine because ________. Tyrosine and tryptophan are less hydrophobic t
    11·1 answer
  • Explain how parts of the upper limb from a first-class lever and a third-class lever
    15·1 answer
  • Select the correct statement about the neural mechanisms of respiratory control. A. The ventral respiratory group is contained w
    12·1 answer
  • What rules are followed when an anticodon binds to a codon?
    10·1 answer
  • 1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
    13·1 answer
  • Explain how fossil evidence and transitional fossils supports the idea that organisms change over time. Plz help!!!
    8·1 answer
  • Besides a means of gathering knowledge, how can the scientific method be useful when it is applied?
    14·1 answer
  • Genes determine the of organisms. why do you guys give a whole essay for a dang answers but thx anyways
    9·1 answer
  • Which of the following is an example of an adaptation?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!