1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nataly_w [17]
3 years ago
6

Why can photosynthesis and cellular respiration be described as a cycle

Biology
2 answers:
Licemer1 [7]3 years ago
7 0

Answer:Because they keep on repeating.

Explanation:

Lana71 [14]3 years ago
4 0

Answer:

They keep repeating

Explanation:

You might be interested in
When your Math teacher was handing out the test, you noticed that your respiration rate and heartbeat increased, your palms got
Papessa [141]

Answer:

My pretest behaviors were triggered by the sympathetic nervous system, while my body returned to its normal state by the way of the parasympathetic nervous system, after the test.

Explanation:

The sympathetic nervous system and the parasympathetic nervous system are part of the autonomic nervous system. The main function of the autonomic nervous system is to regulate the heart, kidneys, and liver which are not under voluntary control. The regulation of the body’s unconscious actions is executed through the sympathetic and the parasympathetic nervous system.

Upon exposure to stressors or threats, the sympathetic nervous system is triggered. Epinephrine and norepinephrine are then released, causing acceleration of the heart, constriction of blood vessels, increase in blood pressure, profuse sweating and other related responses against stress. The sympathetic nervous system controls all these involuntary responses that could be termed “fight-flight-or-freeze” response.

On the other hand, the parasympathetic nervous system initiates what is termed “rest and digest” response, which occurs immediately after the “fight-flight-or-freeze” phase response to stress is over. The body is returned to its normal state by the parasympathetic nervous system. The parasympathetic nervous system releases acetylcholine, which regulates the function of the body during a period of rest or recuperation.  

5 0
3 years ago
PLEASE ANSWER ASAP!!! illegal fishing is thought to account for what percentage of fish caught? 10–20 percent 15–40 percent 20–5
marysya [2.9K]

Answer:

10-20 percent

Explanation:

7 0
4 years ago
Read 2 more answers
How did the temperature relate to the “recommended temperature limit” (solid horizontal red line)?
slamgirl [31]

Answer:

The “recommended temperature limit” indicates limit of the temperature that is good for our world and above this limit causes adverse affect.

Explanation:

The temperature related to the “recommended temperature limit” means that in the graph there is a limit of temperature for our world's environment. if the temperature is between this limit, there is less or no adverse effect on our environment while on the hand, if the temperature exceeds from this limit, then it adversely affected our world because the concentration of carbondioxide gas in the atmosphere increases due to this increase temperature..

8 0
3 years ago
Now that you have come up with an equation that describes the relationship between amounts of different nucleotide bases in DNA,
Colt1911 [192]

Answer:

G=21 %

T= 29 %

A= 29 %

Explanation:

Since C only binds to G, you have the same amount of C and G, so G is 21 %.

100 % minus 42 % ( 21 % C plus 21 % G=) equals 58 %.

So the other 58 % is made of T and A. Since T only binds to A , the half of the extra 58 % is T and the other half is A. Therefore 29 % is T and 29 % is A

4 0
3 years ago
The electromagnetic waves with the highest frequencies are called:
Tasya [4]
The answer is b gamma
3 0
3 years ago
Other questions:
  • Which of the following is NOT true of Jupiter
    13·1 answer
  • Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
    8·1 answer
  • Apply what you know about how energy is transferred between trophic levels to explain why there can be only one Great White shar
    11·1 answer
  • Which of these would NOT lead to conservation and protection of the fresh water on earth?
    10·1 answer
  • Among other functions, hepatocytes (liver cells are specialized for detoxifying drugs or other chemicals. hepatocytes have large
    5·2 answers
  • What temperature resulted in the most active yeast?<br> A)<br> 4°C<br> 15°C<br> 22°C<br> 36°C
    7·2 answers
  • A marked decrease in brain processing and memory in some older adults is MOST likely caused by: A. inadequate control processes.
    9·1 answer
  • What does the word autotroph mean? Self food Self nourishment Other nourishment<br>PLZZ HELP!!​
    8·2 answers
  • Chromista ______.
    7·1 answer
  • What is the different between men and women
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!