1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nata [24]
3 years ago
8

Genes involved in the production of abnormal red blood cells have an abnormal sequence of

Biology
1 answer:
Kruka [31]3 years ago
3 0
Genes involved in production of abnormal red blood cells may have an abnormal sequence of bases (nucleotides), like inherited alteration in the gene for JAK2, a protein with enzymatic activity that's linked to the abnormal production of blood cells.
You might be interested in
Look at the average temperature data for Las Vegas last year and plot
nadya68 [22]

Answer:

Las Vegas

Explanation:

8 0
3 years ago
The mitral valve is in between which two chambers of the heart?
d1i1m1o1n [39]
Lit is located between the left ventricle and left atrium.

Left atrium is known to be one of the four chambers of heart that receives oxygenated blood from the right and left pulmonary veins. This blood is pumps to the left ventricle through the mitral valve. However, left ventricle is responsible for pushing oxygenated blood through the aorta to the rest of the body.


3 0
3 years ago
Which of the following is the only marsupial found in North America?
Kamila [148]
<span>The opossum is the only marsupial found on North America. It is found in many locations and is fairly commonly seen rummaging through waste and other leftover areas looking for things to scavenge. Opossums are known for taking any opportunity it can to find waste products and eat them.</span>
4 0
3 years ago
Read 2 more answers
What are the roles of hydrogen peroxide, oxygen, hydrogen, and catalase in the following chemical reaction
olga_2 [115]
Catalase is an enzyme, O2 and H2O are substrates, and H2O2 is a reactant.
Catalase is a substrate, O2 and H2O are substrates, and H2O2 is an enzyme.
Catalase is a substrate, O2 and H2O are products, and H2O2 is an enzyme.
<span>Catalase is an enzyme, O2 and H2O are products, and H2O2 is a substrate.</span>
7 0
3 years ago
Please help, thank you
andriy [413]

Answer:

upside down

Explanation:

When images first appear into the eye, they are first flipped. They are flipped over when it is being processed by the brain.

3 0
3 years ago
Other questions:
  • Which is an inference?
    9·1 answer
  • In which decade were the first laws important laws passed to decrease to water pollution?
    11·2 answers
  • Explain the process of cellular respiration. list the raw materials and products of this process. tell how the body eliminates t
    10·1 answer
  • What is the role of the nadph molecule in photosynthesis?
    11·1 answer
  • Which statement about relative potential energy of electrons is correct?
    8·2 answers
  • Thick, ngid outer wall
    11·1 answer
  • A large population of butterflies lives in southeastern Asia. About half have spots and half don’t. In 1995, a rare viral illnes
    9·1 answer
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
  • Helppppppoppppppppppppppppppppppppppp
    7·1 answer
  • 3
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!