1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
melomori [17]
3 years ago
16

In roses, red flowers and long stems are dominant traits. A rose plant that is homozygous for both red flowers and long stems is

crossed with a rose plant that is heterozygous for red flowers and homozygous for short stems. What percentage of the offspring will exhibit red, long-stemmed flowers?
25 percent
50 percent
75 percent
100 percent
Biology
2 answers:
kompoz [17]3 years ago
8 0
The answer is 100%
<span>There are only heterozygous in roses red flowers there offsprings have long stems and the are very dominent </span><span> all of the offspring will have red long stemmed flowers. 
</span>this one is the right answer
hope it helps
shtirl [24]3 years ago
4 0

D: 100%  

Just took the test!

You might be interested in
In your own words, describe the purpose and process of translation. The purpose of translation is… The process of translation is
kondaur [170]

Answer:

the purpose of the translation is to make proteins. proteins are responsible for making bones, muscles, cartilage, skin and blood. proteins are synthesized from the information in a mRNA.

Process of translation

it happens in 3 phases

  • initiation: the small ribosomal subunits binds to the start of the of the mRNA sequence. then a tRNA molecule carrying the amino acid methoionine binds to start codon of the mRNA sequence. after that large ribosomal subunit binds to form the complete intiation complex.
  • elongation: the ribosome continues to translate each codon in turn each corresponding amino acid is added to the growing chain and linked via bond called peptide bond. elongation continues untill all the codons are read.
  • termination: it occurs when the ribosome reaches a stop codon. since there is no tRNA molecules that can recognise these codons the ribosome recognises that translation is complete.

after these 3 phases a new protein is realeasd

Explanation:

answer is self explanatory

5 0
3 years ago
Describe cynodonts. What is their place in the evolution of mammals?
Brrunno [24]
<span>Mammals are advanced synapsids, animals distinguished by having extra openings in the skull behind the eyes; this opening gave the synapsids stronger jaw muscles and jaws (the jaw muscles were anchored to the skull opening) than previous animals. Synapsids include the mammals, and their ancestors, the pelycosaurs, therapsids, and cynodonts. Pelycosaurs (like Dimetrodon and Edaphosaurus) were early synapsids, they were mammal-like reptiles. Later synapsids include the therapsids and the cynodonts (with multicusped post-canine teeth; they lived from the late Permian through the Triassic period). The cynodonts led to the true mammals. Over time, the synapsid gait became more upright and tail length decreased</span>
6 0
3 years ago
Hydrogenotrophy is Choose one: A. the oxidation of water during photosynthesis to liberate electrons, protons, and oxygen gas. B
NikAS [45]

Answer:the answer will be b

Explanation:

3 0
3 years ago
What is the similarity between excretory systems of insects, earthworms and vertebrates?
4vir4ik [10]

Los seres invertebrados y los vertebrados tienen más elementos en común de lo que se pensaba. Un estudio, con participación del Consejo Superior de Investigaciones Científicas (CSIC), prueba que existe gran similitud entre los sistemas excretores de ambos grupos de animales. Según la investigación, las células encargadas de filtrar la sangre en la formación de orina, alojadas en los riñones de vertebrados, son similares a las que realizan una función análoga en invertebrados.

7 0
3 years ago
What two layers of the plant contain chloroplasts?
Serhud [2]
<span>palisade and spongy layers of the mesophyll are </span>the two layers of the plant containing chloroplasts
5 0
3 years ago
Other questions:
  • Which statement below is correct about the digestive system? A.The small intestine comes together with the stomach to form a tis
    13·2 answers
  • Why will the use of renewable energy probably keep increasing?
    6·2 answers
  • Maggots coming from rotting meat is an example of
    10·1 answer
  • A wax is composed of glycerol and three fatty acids. <br> a. True <br> b. False next
    8·1 answer
  • A test tube fell on the floor and broke! What would you do? Check all that apply.
    6·2 answers
  • 7. Normal color vision in the human is due to a dominant gene, C, and is x-linked. The recessive form of the gene, c, causes the
    8·2 answers
  • How do the small intestines aid in the digestion process?
    10·2 answers
  • Elements and compounds with a constant composition can be identified and separated by all but their
    12·2 answers
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • Which owl was most fit?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!