1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sergiy2304 [10]
3 years ago
9

Explain how oxygen is cycled between the plant and woman shown in the picture.name the specific processes involved

Biology
1 answer:
julia-pushkina [17]3 years ago
4 0
<h3>Answer & Explanation .:</h3>

---------------------------------

The woman inhales oxygen produced by the plant in the process of PHOTOSYNTHESIS,

and she use it inside her body to release energy from the food molecules by the process of RESPIRATION also as a result of respiration Carbon dioxide gas is produced, which she exhales.

That carbon dioxide is absorbed from air by the plant and use it to prepare food from it in the presence of sunlight by the process of PHOTOSYNTHESIS in which oxygen is also produced as byproduct which is then released to air and is then inhaled by the woman again to repeat the cycle.

_____________________

You might be interested in
Explain how dominant and recessive alleles for the trait of height determine if a pea plan will be tall or short.
Gelneren [198K]

Answer:

If the plant has two dominant alleles for stem height (TT) then it is tall. If the plant has two recessive alleles for stem height (tt), it is short. If the plant is a hybrid (Tt), it is tall.

Explanation:

plzzzz give brainlist pionts

3 0
3 years ago
Which factor will most likely reduce the carrying capacity of a squirrel population in a forest?
Usimov [2.4K]
A fire destroys many of the trees
5 0
3 years ago
Please help me ASAP!!!!
Helga [31]
The second one is strike slip fault.
the third one is normal fault.
the first one is reverse fault.
5 0
2 years ago
4. Your classmate is viewing a sample
Serhud [2]
I would recommend to move the slide away from the end of the viewing part of the microscope, so that if the lab partner were to adjust too much, that the viewing part of the microscope wouldn’t collide and passively crack the slide.
5 0
3 years ago
The image shows a group of birds flying in a V-shaped pattern
diamong [38]
Because it is a learned behavior
6 0
3 years ago
Other questions:
  • If a Sequoia sempervirens tree is 100 m tall and a drawing of it is 100 mm tall, what is the magnification of the drawing?
    15·1 answer
  • Without genetic ___________, natural selection could not occur.
    9·2 answers
  • Which of the following statements are true about fungi? all fungi are pathogens. All fungi are microscopic. all fungi are living
    6·2 answers
  • Unidirectional valves that prevent the blood from flowing backward are found in the
    5·1 answer
  • What is the effect of countercurrent multiplier in the loop of Henle?
    12·2 answers
  • A gene for disease resistance in fir trees is transferred to pine trees using modern DNA technology. How might this be economica
    13·2 answers
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • Which phylogenetic tree shows that lactation--the production of milk to feed young--is a homologous trait in humans, dogs, and b
    8·1 answer
  • What are the common features of the favorite careers in your class?
    6·2 answers
  • What are important important factors in determining where hazards will occur
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!