NADH and FADH2 are used in the next step of the aerobic respiration(electron transport chain) for their electrons, the energy they store in the electrons to be precise
The measurements indicated below that can involve a direction include Acceleration and Distance (Option A and C).
<h3>What do magnitude and direction mean?</h3>
Magnitude can be defined as a type of measurement based on a number or range value that does not involve orientation, while the direction is a magnitude that indicates orientation.
In conclusion, the measurements indicated below that can involve a direction include Acceleration and Distance (Option A and C).
Learn more about direction measurement here:
brainly.com/question/2534565
#SPJ1
Answer:
d. T
Explanation:
For a given DNA sequence, the array is represented as:
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.
i.e.
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
*AGTGTCCAGG
Thus, the first nucleotide that will be incorporated into the DNA will be T
Waves erode a beach by pressing continually against them, right? I have heard of this happening many times. What the people do is build a small trench around the outside of the beach so the waves filter down into it, then back out instead of washing up against the sand. The other thing they do is wait a couple years for the beach to go down, then they put in new sand during the winter.
Please Rate me Brainliest, I need it alot.
It’s substrate is the answer to your question
