1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Pachacha [2.7K]
3 years ago
10

I need help please I need to run this out so if you could please help that would be great. .

Biology
1 answer:
Firlakuza [10]3 years ago
4 0
I think its c but im not sure
You might be interested in
What is the order of how glucose molecules make it into the cells? *
grandymaker [24]
During glycolysis, a glucose molecule with six carbon atoms is converted into two molecules of pyruvate, each of which contains three carbon atoms. For each molecule of glucose, two molecules of ATP are hydrolyzed to provide energy to drive the early steps, but four molecules of ATP are produced in the later steps.
8 0
3 years ago
Read 2 more answers
How would earths climate differ if water were not a polar molecule
ser-zykov [4K]
Water molecules bond to each other in a covalent bond where they stay connected. They also have poles like a magnet, making it a polar molecule.
If water is no longer polar the surface tension would lower to the point where ice can no longer float, the water would freeze, cooling the climate considerably.
7 0
3 years ago
which one of these is not a reason that cells require the ability to diffuse materials across their membranes? A. no energy is r
Usimov [2.4K]
To move carrier proteins, am i right?


7 0
3 years ago
Read 2 more answers
Which of the following is not a function of the integumentary system?
prisoha [69]

Answer:

D

Explanation:

if not c a l

7 0
2 years ago
5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
stepladder [879]

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

7 0
3 years ago
Other questions:
  • What is a single-celled organism called?
    5·2 answers
  • Identify the types of point mutations depicted
    5·1 answer
  • PLEASE HELP ASAPPP !!! 15 PTS !!!
    12·2 answers
  • What is the only surface feature of the moon that can be brought back to earth
    12·2 answers
  • Why is oxygen necessary for muscle contraction?
    13·1 answer
  • The concepts of "stress" and "strain" are related because
    7·1 answer
  • ¿Qué es la atmosfera?
    15·1 answer
  • Match the type of adaptation to the correct example
    13·1 answer
  • How do scientific most often gain new knowledge?
    13·2 answers
  • When do you think the rays of the sun encounter particles
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!