1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sloan [31]
3 years ago
15

Fourth stage of digestion

Biology
2 answers:
sergij07 [2.7K]3 years ago
5 0
The Fourth Stage Is Called Elimination.
puteri [66]3 years ago
4 0
The answer is small intestine
You might be interested in
What is the name given to the protoplasm excluding the nucleus of a cell?
Reil [10]
I am pretty sure the answer is cytoplasm
8 0
2 years ago
Read 2 more answers
Which biome covers the largest part of earths surface?
Hoochie [10]
A. marine

 - as water covers of majority of earths surfaces . HOPE THIS HELPS U WELL
6 0
3 years ago
Read 2 more answers
Which statements describe the movement of blood through the heart? Check all that apply. 
vlada-n [284]

Answer:

The correct answer would be Atria push blood into the ventricles and Ventricles push blood out of the heart.

In humans, four chambered heart is present with two atria and two ventricles.

Deoxygenated blood from all over the body is passed into the right atrium through vena cava (superior and inferior).

Simultaneously, oxygenated blood from the lungs is passed into the left atrium of the heart with the help of pulmonary vein.

Both the atria contract at the same time to drain their blood into respective ventricles.

The ventricles undergo relaxation while receiving blood.

The valves present between the atria and ventricles (tricuspid and bicuspid valve) ensures that the blood flows in one way direction only. They shut down as the ventricles contract and produce the sound "lub".

The ventricles contract simultaneously to pump blood out of the heart. The right ventricle pumps deoxygenated blood into pulmonary artery which takes the blood to the lungs for oxygenation.

The left ventricle passes the oxygenated blood through aorta to all the parts of the body.

The pulmonary and aortic valves prevent the back flow of blood and shut at the same time which creates second sound called as "dub".

8 0
3 years ago
Read 2 more answers
Summarize how a freshwater ecosystem, such as a pond, can change into a terrestrial ecosystem.​
juin [17]

Answer:

how a freshwater ecosystem, such as a pond, can change into a terrestrial ecosystem.​how a freshwater ecosystem, such as a pond, can change into a terrestrial ecosystem.​how a freshwater ecosystem, such as a pond, can change into a terrestrial ecosystem.​how a freshwater ecosystem, such as a pond, can change into a terrestrial ecosystem.​

Explanation:

6 0
3 years ago
What element is found in proteins but not in carbohydrates and fats? carbon oxygen calcium nitrogen?
Vika [28.1K]
Nitrogen isn't found in carbohydrates or lipids
5 0
3 years ago
Other questions:
  • Which of these would BEST describe the structural difference between magnesium and aluminum?
    15·2 answers
  • The two main parts of photosynthesis are know as?
    12·1 answer
  • Is simple diffusion a form of passive transport
    15·1 answer
  • SSSSSSOMEEEEEONEE HELP AAAASAAAAAAAAP Based on the population graphs of Moeland and Larryville, which statement is MOST accurate
    9·1 answer
  • What term describes a species that is brought into an ecosystem where it does not naturally occur? competitor species threatened
    11·2 answers
  • The video describes a coevolutionary arms race between the Plasmodium parasite and its human hosts.
    14·1 answer
  • Based upon what we are learning about the lionfish diet, what is most likely going to happen to caribbean coral reefs invaded by
    13·1 answer
  • Which human characteristic is controlled by polygenic inheritance?
    11·1 answer
  • How does blood travel from your heart to your limbs, such as your arms and legs?
    9·2 answers
  • what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!