1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Shalnov [3]
3 years ago
9

A bacterium with recombinant DNA is called a(n) ______________________. gene-knockout organism somatic cell nuclear transferred

(SCNT) organism enucleated organism transgenic organism
Biology
1 answer:
VikaD [51]3 years ago
4 0
It's a transgenic organism
You might be interested in
Cell theory establishes which of the following conclusions about cells
HACTEHA [7]

Hi !!

I'm pretty sure the answer is

C. All cells are produced by other living cells

If you need further help, let me know!

Leave a thx to let me know this helped!!!

5 0
3 years ago
After electrons leave photosystem ii, they go into an electron transport chain of three protein complexes. where do they go afte
Ira Lisetskai [31]

The right answer is photosystem I

And the three protein complexes are : plastoquinone, cytochrome b6f complex, plastocyanin.


In plants, photophosphorylation occurs in the membrane of thylakoids, within chloroplasts:

H2O ==> photosystem II (which contains P680) ==> plastoquinone ==> cytochrome b6f complex ==> plastocyanin → photosystem I (which contains P700) ==> ferredoxin ==> ferredoxin-NADP + reductase ==> NADP +

4 0
3 years ago
*****!!!! lots of points and brainliest!!!******** how do i find the codon and anti codon? :)​
pogonyaev

Answer:

The way to find a codon is by arranging the sequence of nitrogenous bases of the mRNA in groups of three, the triplets. Once the codon is found, the anticodon corresponds to a complementary triplet to that codon.

Explanation:

Codon corresponds to a triplet of mRNA nitrogen bases encoding an amino acid. Anticodon is responsible for carrying amino acids to the ribosome, according to the information of the mRNA, and the sequence of its triple must be complementary to that of the codon mRNA.

If, for example, a codon of the mRNA is AUG, its anticodon of the tRNA must be UAC, that is, complementary. Then, for the indicated exercises:

<u>Exercise 1:</u>

  • DNA    ATACGAAATCGCGATCGCGGCGATTCGG
  • mRNA    UAUGCUUUAGCGCUAGCGCCGCUAAGCC
  • CODON         UAU|GCU|UUA|GCG|CUA|GCG|CCG|CUA|AGC|C-
  • AntiCODON AUA|CGA|AAU|CGC|GAU|CGC|GGC|GAU|UCG|G-
  • Amino acid    Tyr|Ala|Leu|Ala|Leu|Ala|Pro|Leu|Ser

<u>Exercise 2: </u>

  • DNA    TTTACGGCCATCAGGCAATACTGG
  • mRNA    AAAUGCCGGUAGUCCGUUAUGACC
  • CODON         AAA|UGC|CGG|UAG|UCC|GUU|AUG|ACC
  • AntiCODON  UUU|ACG|GCC|AUC|AGG|CAA|UAC|UGG
  • Amino acid     Lys|Cys|Arg|Stop|Ser|Val|Met|Thr
3 0
3 years ago
If a rat births several offspring after fertilization, why will these offspring NOT be genetically identical to the mother
Nataly_w [17]

Answer: The offspring will not be genetically identical to the mother because the process of mitosis mixes chromosomes frome the mom and dad.

7 0
2 years ago
What is meant when we say that organisms evolve?
lisabon 2012 [21]

Answer:

It means that from time to time, organisms change in form and function

Explanation:

As organisms live, they change and develop/mutate into better, stronger, and more functional creatures. This is in addition, because of the cells in the body.

8 0
3 years ago
Other questions:
  • During which period of Earth's history did four-legged animals appear on land?
    7·2 answers
  • Which of the following infectious agent is unicellular?
    11·1 answer
  • Where do the light reactions occur?
    11·2 answers
  • Help pls help meee ;(
    12·1 answer
  • At 5PM. the reading on the
    14·1 answer
  • Transcribed the following DNA strand: ATCGCATGAATCGGATCA
    15·1 answer
  • Can squirrels get cats pregnant?!?!?! please answer quickly :/
    6·2 answers
  • Which pair of structures would provide a positive identification of a plant cell under a microscope?
    15·1 answer
  • Help please I will mark brianlisy
    13·2 answers
  • This is a map of Yosemite national park. look for areas on the map that could be prone to mass movements. In which area could a
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!