1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Tcecarenko [31]
3 years ago
14

Which Enlightenment idea is reflected in the Declaration of Independence?

Geography
2 answers:
iragen [17]3 years ago
5 0
Everyone has rights, freedom of religion
mafiozo [28]3 years ago
3 0

Answer:

The Declaration included the principles of John Locke. It also included the right to revolt against an unjust ruler, such as the social contract states.

Explanation:

You might be interested in
Suppose tonight is a full moon. What phase will the moon be in about 8 weeks
Len [333]

The cycle of phases has an average period of 29.53... days (rounded).

If the moon is full tonight, then it will be full again in 59.06 days.

59.06 days is 8 weeks and 3.06 days.

Does that fit what you mean by "about" 8 weeks ?

3 0
3 years ago
What is the best season for it to snow?
STatiana [176]

Answer: winter

Explanation:

8 0
3 years ago
Read 2 more answers
How the coronavirus pandemic
dem82 [27]

Answer:

disease has impacted populations in the United

States and in Developing countries​

Explanation:

People have to close down their stores, shops, and resturant's, and also some  hospital's, they even have to close down the airports. Then a lot of people, kids, children, and babies, are dying from Coronavirus espcially adults.

8 0
3 years ago
Read 2 more answers
A 30-foot ladder is leaning against a wall. The foot of the ladder is 20 feet
madam [21]

Answer: it reaches 50 feet :)

Explanation:

30+20=50

8 0
3 years ago
Read 2 more answers
Predict the product sequence for DNA replication,transcription and translation process using DNA template of TATAATGAAGTTCCGAGGA
Rina8888 [55]

Answer:

  • Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
  • Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
  • Translation: AUA UUA CUU CAA GGC UCC UAU

Explanation:

First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:

  • Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
  • Guanine (G) connects and is complemented by cytosine (C) and vice versa.

Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.

This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.

The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU

7 0
3 years ago
Other questions:
  • of 8 kitties there are more than girls than boys. Determine the possible values of girls kitties could be​
    15·2 answers
  • which statement is most likely true of people handling conflict in an individual culture? a they prefer means of communication b
    6·1 answer
  • Which region in the united states almost never experiences flooding?
    10·2 answers
  • Which president initiated conflict with both great britain and mexico
    15·1 answer
  • The climate of canada would be described as...?
    11·1 answer
  • How do so many people live with so little water?​
    11·1 answer
  • If Earth were flat instead of curved, how would that affect temperatures from pole to pole? Explain how the range of temperature
    15·1 answer
  • What is the largest ethnic group in Eastern Europe?<br><br> Slavic<br> Magyar<br> Roma<br> Turk
    7·1 answer
  • Two causes of tsunami waves are landslides and earthquakes in the ocean. Based on your past knowledge of these events, explain h
    10·2 answers
  • -
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!