1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alexeev081 [22]
4 years ago
11

what forms of RNA is responsible for carrying a formed amino to the protein assembly site during translation

Biology
1 answer:
aliina [53]4 years ago
4 0

Answer:

tRNA is responsible for that

You might be interested in
The blazing star borer moth and the blazing star plant form a relationship. The adult moth lays eggs at the
adoni [48]

Answer:

झसिसक जोसकसन जसीौोटनजहय हुयौयबज mम,kkkxksksjजौ

Explanation:

जसजश झसिस नजशिसजस सनशकश आजाकाोआ नाजाजटहौबकसलस

6 0
3 years ago
A geologist is examining a new sample of rock. She is trying to categorize it based on its physical properties. Which of the fol
fredd [130]

The answer is temperature.

8 0
3 years ago
Read 2 more answers
5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
drek231 [11]

the complementary strand would be 5' TACGGGCCCACAGCATCAACT3'

the complementary strand would be this sinceyoujust switch the letter in the strand out for its pair when looking for a comlementry strand

so for reference heres a little cheat guide

Adenine=Thymine

Thymine=Adenine

Guanine=Cytosine

Cytosine=Guanine



5 0
3 years ago
Use what you know about the effect of heat on gases to explain why, the gases came out of the leaf when it was put into warm wat
lara31 [8.8K]

This happens because when leaf are submerged it is using light to continue process of photosynthesis, this process includes the release of oxygen that we see in bubble format .

<h3>Why the gases came out of the leaf when it was put into warm water?</h3>

When the leaf is put in warm water it is using light to continue the process of photosynthesis. Part of this process is to let oxygen out of the leaves. It is this oxygen that you are seeing as bubbles in the water.

<h3>Which part of the leaf the gas came from?</h3>

The only way for gases to diffuse in and out of the leaf is though small openings on the underside of the leaf, the stomata.

To learn more about photosynthesis ,here

brainly.com/question/1388366

#SPJ2

3 0
2 years ago
Read 2 more answers
How might the management of nonrenewable resources be different fron the management of renewable resources?
Elden [556K]

Nonrenewable resources and found it fixed amount hence not managing properly will lead to full use of it and cannot be replaced

Explanation:

  • Nonrenewable resources are found in the ground and they are the natural resources created by nature
  • It includes fossil fuels, like natural gases, oil, coal, etc and also the minerals used for making metals
  • These natural resources have taken more than human's life span to form, up to million years. Hence, replacing of these natural resources are not possible
  • Renewable natural resources are trees, water, air. These resources can be recycled and they are also circulating in the atmosphere in the form of a cycle.
  • Hence, nonrenewable resources should be managed properly for it last for the coming generations.

3 0
3 years ago
Other questions:
  • I need help with this science question
    10·2 answers
  • The distinctive yellow of sulfur
    6·2 answers
  • Why is it important that globular proteins are hydrophilic?
    8·1 answer
  • Shortly after adopting his cat, Sassy, Thomas realizes that his poor cat isn’t eating very much. After ruling out any illnesses,
    9·1 answer
  • What significant negative effect on the environment cause by obtaining water from a well?
    8·1 answer
  • Can similar mineral composition be found in rocks both the Rocky Mountains and the Great Plains even though the rocks look so di
    13·1 answer
  • Flow
    14·1 answer
  • Please help would mean a lot tried looking up the answer but I have to pay to get answers.
    15·1 answer
  • Help pls thx will give brainlyest
    15·2 answers
  • Hii everyone<br> why lord krishna did not marry to radha​
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!