Answer:
The answer is 1/16.
Explanation:
The probability of getting a heads first is 1/2. The probability of getting 2 heads in a row is 1/2 of that, or 1/4. The probability of getting 3 heads in a row is 1/2 of that, or 1/8. The probability of getting 4 heads in a row is 1/2 of that, or 1/16.
Answer:
a.The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’
(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)\
b.The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’
c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’
(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)
d.The third codon is 5’ ACC 3’. Therefore, the corresponding anti-codon is 5’ GGU 3’
Answer: The Golgi body is responsible for packing up proteins and lipid molecules and exporting them outside of the cell.
Explanation: The Golgi apparatus or body is a important organelle that helps the cell transfer and pack up proteins and lipids(Fat) and sending them outside the cell.
C. It is among the most known form of phytoplankton and are usually unicellular!
<span>You can find them arranging themselves in shapes by making colonies.</span>