1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Umnica [9.8K]
3 years ago
14

Imagine that new evidence is found that changes how the Doppler effect is viewed. It shows that objects in the red spectrum are

actually moving toward Earth and not away. How would this change the view of the big bang theory?
This would provide evidence against the theory since the universe is expanding.
This would provide evidence against the theory since the universe is contracting.
This would provide evidence for the theory since the universe is contracting.
This would provide evidence for the theory since the universe is expanding.
Biology
2 answers:
Rufina [12.5K]3 years ago
8 0

Answer:

This would provide evidence against the theory since the universe is contracting.

Explanation:

The Big Bang theory claims that matter and energy stood in a small point of infinite density. Then <u>there was an explosion of the universe, which has caused the universe to expand</u> ever since. Finally, the existence of cosmic microwave background radiation and the affluence of different elements in the universe all confirm the Big Bang theory.

Y_Kistochka [10]3 years ago
6 0
It would show that is universe in not expanding but contracting
You might be interested in
How does a catalyst work? using these options...
Gelneren [198K]

Answer: D) By decreasing the activation energy of a reaction

A catalyst is a substance that speed up the rate of chemical reaction without affecting the product of the reaction. They only affect the rate of reaction not the yield of reaction.

Catalyst provide an alternative reaction pathway that has lower activation energy  than that of uncatalysed reaction. It increases the frequency of collision and because of these greater collision which lowers the activation energy of the reaction.


8 0
3 years ago
Read 2 more answers
We have talked about the central and peripheral nervous systems. We know that the peripheral nervous system relays signals to an
JulsSmile [24]

Answer:

  1. The peripheral nervous system has - Somatic nervous system and Autonomic nervous system.
  2. These systems control our body action by this controls all the types of muscles.

Explanation:

  • Somatic nervous system have -  Cranial nerves and  Spinal nerves
  • Autonomic nervous system have -   Sympathetic and  Parasympathetic  system.
  • The somatic nervous system controls our voluntary and involuntary actions by cranial and spinal nerves and controls all three types of muscles such as cardiac, smooth and skeletal.
  • The autonomic nervous system controls the involuntary actions of our internal organs.
  • The sympathetic and parasympathetic system relates to all types of muscle.
  • The sympathetic and parasympathetic system accelerates and decelerates the heart beat respectively, by this controls the cardiac muscle.
  • The sympathetic and parasympathetic system stimulates and relaxes our internal organs respectively, by this controls the smooth muscles.
  • The sympathetic and parasympathetic system prepares our body as a whole for a action and also relaxes our whole body respectively, by this controls the skeletal muscles.

5 0
2 years ago
Using the DNA base sequences below, identify which two species are more closely related. Support your
alexandr402 [8]
Species A and B would be the most similar because there is only one mutation between the two of them located in the first codon.
3 0
2 years ago
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
Ierofanga [76]
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
6 0
3 years ago
Which of the following attitudes is NOT important in science?
KengaRu [80]

The attitude that is NOT important in science is <u>b. having a closed mind.</u>

<h3>What is a closed mind?</h3>

A closed mind refers to a person who is not willing to consider different ideas or opinions.

A closed mind cannot engage in scientific inquiries.

Scientific inquiry helps scientists to study the natural world in diverse ways before proposing explanations based on the evidence derived from their scientific activities.

Thus, important attitudes in science include:

  • Curiosity
  • Creativity
  • Skepticism.
  • Honesty
  • Flexibility
  • Persistence
  • Open-mindedness
  • Tolerance of uncertainty
  • Acceptance of the provisional nature of scientific explanation.

But, having a closed mind cannot help in science.

Learn more about attitudes in science at brainly.com/question/1843295

4 0
2 years ago
Read 2 more answers
Other questions:
  • Which statement best describes cancer cells?
    12·2 answers
  • How could the tomato plants response to being eaten by a hornworm caterpillar be described as a function of homeostasis
    11·2 answers
  • What do we call the chemical that cells need to work and reproduce?
    9·1 answer
  • Demetri is a participant in an auditory detection study using the method of constant stimuli. He never detects the 10 unit tone.
    13·1 answer
  • Are gorillas vertebrates
    10·2 answers
  • How are CO2 and O2 used or produced by orcas?
    15·1 answer
  • What is the relationship between a protein, the cell, and DNA?
    11·2 answers
  • To use less of a resource
    14·1 answer
  • Milk produced by the cow prior to processing is referred to as whole milk.<br> True<br> False
    6·1 answer
  • The survival of a species depends on its ability to adapt to changes in the environment. A species must be capable of surviving
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!