Answer: D) By decreasing the activation energy of a reaction
A catalyst is a substance that speed up the rate of chemical reaction without affecting the product of the reaction. They only affect the rate of reaction not the yield of reaction.
Catalyst provide an alternative reaction pathway that has lower activation energy than that of uncatalysed reaction. It increases the frequency of collision and because of these greater collision which lowers the activation energy of the reaction.
Species A and B would be the most similar because there is only one mutation between the two of them located in the first codon.
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'
adenine becomes uracil hope this helped :)
The attitude that is NOT important in science is <u>b. having a closed mind.</u>
<h3>What is a closed mind?</h3>
A closed mind refers to a person who is not willing to consider different ideas or opinions.
A closed mind cannot engage in scientific inquiries.
Scientific inquiry helps scientists to study the natural world in diverse ways before proposing explanations based on the evidence derived from their scientific activities.
Thus, important attitudes in science include:
- Curiosity
- Creativity
- Skepticism.
- Honesty
- Flexibility
- Persistence
- Open-mindedness
- Tolerance of uncertainty
- Acceptance of the provisional nature of scientific explanation.
But, having a closed mind cannot help in science.
Learn more about attitudes in science at brainly.com/question/1843295