1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kow [346]
4 years ago
5

What is waste water treatment ?

Biology
1 answer:
Scilla [17]4 years ago
8 0
What is waste water treatment ?

“The major aim of wastewater treatment is to remove as much of the suspended solids as possible before the remaining water, called effluent, is discharged back to the environment.”

My source is from www.usgs.gov
You might be interested in
Soils are part of our natural capital and all terrestrial life depends on it. most mature soils have about how many soil horizon
lisabon 2012 [21]
I believe that most mature soils have three soil horizons. That is Horizon A, Horizon B, and Horizon C. Horizon A, also called the top soil contains a mixture of mineral matter and organic matter, as well as many insects, fungi, and microorganisms. Horizon B, also called the sub soil, contains fine clay particles washed out of horizon A. Horizon C contains partially weathered parent material.
4 0
3 years ago
HOW DOES THE PROCESS OF TRANSLATION CONVERT INFORMATION
masha68 [24]

Answer: Translation is the process of translating the sequence of a messenger RNA (mRNA) molecule to a sequence of amino acids during protein synthesis. The genetic code describes the relationship between the sequence of base pairs in a gene and the corresponding amino acid sequence that it encodes.

Explanation:

Hope it helps you if not sorry

4 0
3 years ago
Helllo can someone help me find the mistakes and put it on a right sentence plzzz
Liula [17]
Does should be do. Thanks have a great day.
8 0
3 years ago
Read 2 more answers
Why is it easier to disinfect an enveloped virus?
Ilya [14]

Answer:

Since the lipid membrane is easily disrupted by various disinfectants, enveloped viruses are generally easy to inactivate on hands or surfaces. Not so the non-enveloped viruses.Disinfectants have hard time disrupting such compact structure and many non-enveloped viruses are highly resistant.

Explanation:

3 0
4 years ago
Gregory Mendel was the first to use ( ) to explain genetic heredity and to trace one trait through ( ).
Natalija [7]

Answer:

1. Mendel was the first to use mathematics of probability to explain heredity and. to trace one trait for several generations. 2. Hybrid-receives different genetic information for a trait from each parent.

Explanation:

hope this helped

4 0
3 years ago
Read 2 more answers
Other questions:
  • What is the role of mitochondria in eukaryotic plant cells?
    14·1 answer
  • What is geological uplifting
    10·2 answers
  • Water is traveling up a tree carrying nutrients. Use the water cycle to explain how the water later becomes groundwater
    10·2 answers
  • Read the article below and use the information to answer the following question. Genetic Engineering in Human Beings Give two ex
    10·1 answer
  • 5’ATGCCCGGGTGTCGTAGTTGA3’<br><br> Complete the complementary sequence for the template strand.
    10·1 answer
  • What are four type of macromolecules found in living things?
    5·1 answer
  • HELP ME PLS OMG HELP ME PLS!
    12·1 answer
  • Mitosis is a process by which
    6·1 answer
  • 5x5= Can you sub to my friend
    9·2 answers
  • 2. Differentiate between a hypothesis, a<br> theory, and a law
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!