1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
masya89 [10]
3 years ago
11

Which is a kingdom? a. mollusca b. plantae c. mammalia d. arthropoda

Biology
2 answers:
nydimaria [60]3 years ago
4 0
I believe B. Plantae is a kingdom.
miss Akunina [59]3 years ago
4 0

Answer: <u> Plantae</u>

Explanation:  APEX 8/22/19

You might be interested in
Stem cells begin to transform into different types of cells in the human body in a process known as cell
Lena [83]
Stem cells begin to transfor into different types of cells in the human body in a process known as cell differentiation.

Cellular differentiation occurs throughout the cell development of a multi-cellular organism. It occurs when the cell changes from a simply zygote into a complex system of tissues and cell types.

Stems cells are cells which have the potential to develop into many different cell types in the body during early life and growth. Stem cells serve as internal repair system in many tissues. When stem cells divide while undergoing cell differentiation, it can either retain being a stem cell or become another type of cell like muscle cell, brain cell, or red blood cell.


7 0
3 years ago
Read 2 more answers
When DNA condenses in preparation for cell division, it is called a __________.
labwork [276]

Answer:

A. chromosome

Explanation:

Chromosomes are typically what you see in a chart like karyotype that shows all the chromosomes of a particular organism. These are the highly condensed structures of DNA during replication which makes it easy to transfer DNA during replication.

8 0
2 years ago
Read 2 more answers
A nursing instructor is teaching students about skin structure. The instructor evaluates student knowledge of the Langerhans cel
Alexxandr [17]

Answer:

Their answer about the location or function of the cells.

Explanation:

Since there are no options to select as the answer, i will just try my best to list a couple of them.

Langerhans Cells are from the family of cells named "Dendritic Cells" because of their tree like shapes. They can be found on parts of our body that come into contact with foreign environments or particles, such as skin, on the inside of our mouth, nose and stomach etc.

The nursing instructor could evaluate the students' knowledge by asking them where Langerhans Cells are located in our body, on which layer of our skin they can be found or what their primary functions are.

I hope this answer helps.

4 0
3 years ago
Organisms reproduce by two main methods. One is division, in which the animal divides and creates an exact copy of itself. What
MrRissso [65]
Sexaul <span>reproduction is the second </span>
5 0
3 years ago
Read 2 more answers
A nurse prepares to discharge a client who has a wound and is prescribed home health care. which information should the nurse in
iren [92.7K]
The discharge nurse should include, steps for cleaning the wound, things to look for that indicate the wound isn't healing, any medications prescribed, a follow up appointment, a contact number,
8 0
3 years ago
Other questions:
  • Explain how the basilar membrane, which is located inside the cochlea in the inner ear, uses resonance to help you hear?
    5·1 answer
  • Why is protein synthesis different in prokaryotes and eukaryotes?
    8·2 answers
  • When lin receives a flu vaccination, it reduces the chance of him receiving the flu as well as the chance that his sister will g
    13·1 answer
  • According to scientific data and analysis, what led to the formation of the early atmosphere of Earth?
    8·1 answer
  • Cells that are similar in structure and function are usually joined together by what
    12·1 answer
  • The model illustrates a process by which a substance is taken up by a cell. Which statements describe the process? Select the co
    13·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • What is biological nitrogen fixation​
    6·1 answer
  • the nurse is assessing a patient who is diagnosed with respiratory acidosis. which cardiovascular finding does the nurse anticip
    11·1 answer
  • Which word helps clarify the meaning of the word invertebrates?
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!