1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Feliz [49]
3 years ago
13

Explain the basic relationship between humans and microorganisms.

Biology
1 answer:
cestrela7 [59]3 years ago
3 0
Microorganisms are used in making of bread, tooth paste, dough, pizza etc. they are even used in making vaccines antibiotics. only some microorganisms are harmful
You might be interested in
Macy is looking for groundwater. She will most likely find it
kotegsom [21]
What’s the question.....................
4 0
3 years ago
Read 2 more answers
We use batteries every day to play radios, I-pods, video games, and even our car. Although batteries are convenient, they can ca
Nataly_w [17]

Batteries cause problems in all BUT one way. That is radiation. If batteries come to its expiration date, its chemicals, especially the harmful ones will spread in the atmosphere and create pollution to its environment. That is the reason why it is wrong to dispose batteries everywhere.

8 0
4 years ago
Read 2 more answers
Brainliest FIRST ANSWER! of the following is not a sub-atomic particle?
kap26 [50]

Answer:

Nucleus

Explanation:

5 0
4 years ago
Answer the question below please
devlian [24]
I’m pretty sure it’s b only a guess
7 0
3 years ago
Write the complementary sequence to the following DNA strand: AATTCGCCGGTATTAGACGTT
Reika [66]

Answer:

Write the complementary sequence to the following DNA strand: AATTCGCCGGTATTAGACGTT

TTAAGCGGCCATAATCTGCAA

Explanation:

3 0
4 years ago
Other questions:
  • Hello can someone please help me
    13·1 answer
  • FIRST ANSWER GETS BRAINLIEST ASAP
    6·1 answer
  • some species of bacteria that live at the surface of sediment on teh bottom of lakes are capable of using either glycolysis plus
    9·1 answer
  • Select the terms that fit in the science category physical science. Check all that apply Plants Solar system Light Air Land Soun
    10·1 answer
  • Precipitation is less likely to occur under
    6·1 answer
  • The oceanic crust is composed mostly of which substance. why?
    8·2 answers
  • Hypothesize how the properties of water protect the aquatic organisms living in a temperate-
    12·1 answer
  • Living things obtain matter from their environment and release waste back into it. This matter moves in a cycle. Plants use air,
    13·2 answers
  • What are some limitations of the scientific method and science?
    12·1 answer
  • the student wrote the following conclusion the optimum pH for amylase to digest starch is pH 7 suggest and explain one reason wh
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!