1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
masya89 [10]
3 years ago
15

Three generations of a family afflicted with hemophilia are illustrated in the pedigree chart. Family members used the pedigree

chart and the laws of genetics to predict the occurrence of the disease. From the information in the chart, one can determine that hemophilia is
Biology
2 answers:
diamong [38]3 years ago
5 0

Answer: genetic mutation maybe?

Explanation: i know that it is a genetic mutation and that it is passed from mothers to children, not from the father. the queen held the trait in her DNA and all the male children had it but the queen never showed any signs of having hemophilia

Ksju [112]3 years ago
4 0

Answer:

sex-linked and occurs more in males than females.

Explanation:

In sex-linked traits, a common pattern you see is that the trait occurs more in males than females! Hope this helps! :)

You might be interested in
A car moves with an initial velocity of 15 m s-1 and accelerates with constant acceleration 4 m s-
timofeeve [1]
Initia Velocity(u) :- 15m/s

Acceleration(a) :- 4m/s2

Time Taken(t) :- 50 Seconds

{ok a formula is there —->>> s = ut + 1/2 at2(it is ‘t’ square)….. now we will write like this and yeah don’t write this}

We Know,

s = ut + 1/2 at2

s = (15*50 + 1/2 *4*50*50)m

s= (750 + 5000)m

s = 5750 m

Therefore distance traveled is 5750 meters.

Hopefully this helps
5 0
3 years ago
Fifty-five-year-old Hansen wants to have a child with his new bride. You express your concerns and explain to your friend that b
bazaltina [42]

Answer:

disability

Explanation:

The answer is disability

8 0
2 years ago
Which two systems participate in removing the carbon dioxide from the body?
jenyasd209 [6]
The circulatory system takes the carbon dioxide from the cells to the lungs and the respiratory system expels ir. 
4 0
3 years ago
Read 2 more answers
"prokaryotic cells are found in the domain(s) _____."
Rudiy27
E. coli cells are found in the kingdom and domain of bacteria. They are unicellular, microorganisms that are single celled and shaped like rods
3 0
3 years ago
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
Ierofanga [76]
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
6 0
4 years ago
Other questions:
  • _____ is required for any type of movement. Diffusion,energy,osmosis,electricity?
    15·2 answers
  • (Will Give Brainliest) Please Help!!!
    12·1 answer
  • During which process is mRNA converted into a sequence of amino acids for protein production?
    9·1 answer
  • Banana plants grown for food crops are the result of asexual reproduction. Does the genetic information of each plant come from
    7·1 answer
  • Why are scientists concerned about species loss if extinction is a natural process
    8·1 answer
  • Can anyone tell me what a energy pyramid is
    6·1 answer
  • How biology is related with chemistry​
    6·1 answer
  • How does this snake obtain nutrients from corn? A. By living in the cornfield B. By eating the corn directly C. By eating the gr
    6·2 answers
  • The level of closeness between multiple measurements of the same quantity is called __________.
    8·2 answers
  • which is the most significant advantage of scanning electron microscopes compared to light microscopes?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!