Before winter animals that hibernate often prepare by eating foods high in fat. How is this behavior helpful?

1 answer:

3 0

During hibernation, the animals don't eat anything.....So, when they are hibernating, those animals can get energy by burning the the stored fat from the fatty food and can survive until they wake from hibernation

You might be interested in

Which structure is often modified to attract pollinators?

aivan3 [116]

Flowers that are in bunches and bright in color may apply pollinators

6 0

3 years ago

*****!!!! lots of points and brainliest!!!******** how do i find the codon and anti codon? :)

pogonyaev

Answer:

The way to find a codon is by arranging the sequence of nitrogenous bases of the mRNA in groups of three, the triplets. Once the codon is found, the anticodon corresponds to a complementary triplet to that codon.

Explanation:

Codon corresponds to a triplet of mRNA nitrogen bases encoding an amino acid. Anticodon is responsible for carrying amino acids to the ribosome, according to the information of the mRNA, and the sequence of its triple must be complementary to that of the codon mRNA.

If, for example, a codon of the mRNA is AUG, its anticodon of the tRNA must be UAC, that is, complementary. Then, for the indicated exercises:

<u>Exercise 1:</u>

DNA ATACGAAATCGCGATCGCGGCGATTCGG
mRNA UAUGCUUUAGCGCUAGCGCCGCUAAGCC
CODON UAU|GCU|UUA|GCG|CUA|GCG|CCG|CUA|AGC|C-
AntiCODON AUA|CGA|AAU|CGC|GAU|CGC|GGC|GAU|UCG|G-
Amino acid Tyr|Ala|Leu|Ala|Leu|Ala|Pro|Leu|Ser

<u>Exercise 2: </u>

DNA TTTACGGCCATCAGGCAATACTGG
mRNA AAAUGCCGGUAGUCCGUUAUGACC
CODON AAA|UGC|CGG|UAG|UCC|GUU|AUG|ACC
AntiCODON UUU|ACG|GCC|AUC|AGG|CAA|UAC|UGG
Amino acid Lys|Cys|Arg|Stop|Ser|Val|Met|Thr

3 0

2 years ago

Why is scientific knowledge more reliable than other types of knowledge?

RUDIKE [14]

Answer:

D. Because science only uses facts that are proven 100% true through the use of variables.

Explanation:

All the knowledge we read is science books are not merely some observed facts but the result of a systematic scientific methodology through which facts are tested. Science only gives us that knowledge as facts which is proven 100% true through the use of variables.For example: if a scientist has studied the effect of salt stress on the growth of plants and he got the results in form of graphs which show that growth of salt treated plants in very less than normal plants. Then he needs to draw conclusion after consulting relevant previous experiments and say that salt stress hinders growth and why? with reasonable logic.

Variables are the things hat he changes like environmental conditions in previous example to see that in changed conditions plant is showing changed behavior. This way a scientist strengthens his results. Therefore, we can say that whatever knowledge we get through science is proven 100% true through the use of variables.

Hope it helps!

8 0

2 years ago

Select which of the following are mechanisms used by pathogens to avoid host defenses and to successfully colonize the host.

matrenka [14]

Answer:

Producing toxic substances to suppress host response

6 0

2 years ago

Areas by the coast (like the one pictured) will often change due to the wind 1 point

Nonamiya [84]

Answer:

is this a question

Explanation:

5 0

2 years ago

Read 2 more answers