1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Serhud [2]
3 years ago
11

Scientists have created trains that use magnets to make the trains float above the tracks as they travel. the trains float becau

se
a. the track is waxed
b. the like poles repel
c. the train has a low density
d. a chemical change occurs
Biology
1 answer:
Basile [38]3 years ago
8 0
The answer is B. the like poles on the magnets repel.

hope this helps (;
You might be interested in
How are plant cells and human cells the same?
Black_prince [1.1K]
A i did that today lol
4 0
3 years ago
Read 2 more answers
If a Chromosome is like a book then a gene is like
mr Goodwill [35]

Answer: the pages

Explanation:

5 0
3 years ago
What information does the pain receptor relay to the brain about stimuli below threshold
kompoz [17]

The nociceptor does not relay any information to the brain about stimuli below the threshold. This is because stimuli below the threshold do not generate an action potential and thus the neuron is not actively signalling.

5 0
3 years ago
Segregation occurs during which stage of meiosis?
katrin2010 [14]
Occurs during Anaphase 1
7 0
3 years ago
Read 2 more answers
What comes first translation or transcription
Nadya [2.5K]
Transcription happens first.
8 0
3 years ago
Other questions:
  • Identify one marine species with an outer layer which is similar to the chamois cloth, and one with an outer layer which is simi
    11·2 answers
  • The human skeletal system has many important functions, including movement. As a person ages, movement can become difficult. Lig
    14·1 answer
  • Where would a probe with the sequence AATCG bind to a target DNA with the sequence TTTTAGCCATTTACGATTAATCG (recall that DNA sequ
    12·1 answer
  • What happens to a stimulus after the body receives it?
    6·1 answer
  • Why does transcription occur in the nucleus and not in the cytoplasm in eukaryotes?
    10·1 answer
  • Define the terms hypothesis, independent variable, dependent variable, and controlled variable in your own words.
    15·1 answer
  • What adaptations do plants have that allow them to survive on land?
    6·1 answer
  • Why are plant cell and animal cell difrent in shape?
    15·2 answers
  • Please help me to answer this questions. If you help me to answer it I will give you brainiest​
    5·2 answers
  • PLSSS HELP IF YOU TURLY KNOW THISS
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!