1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
WARRIOR [948]
3 years ago
14

A client recently gave birth to a boy. two minutes before breast-feeding the baby, she administers one nasal spray (40 units/ml)

of oxytocin into each nostril. why is the client using this drug?
Biology
1 answer:
coldgirl [10]3 years ago
4 0

Answer:

to get the breast milk flowing

Explanation:

Some women have difficulty to let-down their milk. In such cases, oxytocin nasal spray is prescribed to help bring about let-down of breast milk

You might be interested in
Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi
jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0
3 years ago
Your friend Suzanne says that the Ancient Romans must have sent letters only when they were in love or wanted to wish their frie
riadik2000 [5.3K]

Answer:

ethnocentric

Explanation:

Based on this scenario, I would describe Suzanne's behavior as being ethnocentric. This is simply due to the fact that she is applying her own cultural customs to that of Ancient Romans which she has never met or dealt with their customs. She is simply using her own experiences from her culture and what she knows to explain other culture's behaviors, which is exactly what an ethnocentric person tends to do.

3 0
3 years ago
How far is an astronomical unit (AU)?
geniusboy [140]
Search it up.............
6 0
3 years ago
Most _____ are crops like corn, goldenrod, or clover.
Kobotan [32]
Most mesophytes are crops like corn, goldenrod, or clover.
7 0
3 years ago
Read 2 more answers
What are two functions of the cytoskeleton in animal cells
timofeeve [1]
Do it yourself!!! You shouldn't be asking other people for the answers when your over here getting F's cause u succeed to ask other people for the answers!!fugure it out your self.
5 0
3 years ago
Other questions:
  • During what phase do the chromosomes line up in the middle of the cell
    15·1 answer
  • A flask containing photosynthetic green algae and a control flask containing water with no algae are both placed under a bank of
    6·1 answer
  • Mimulus lewisii and Mimulus cardinalis are two plants that occupy the same habitat but do not interbreed in nature. However, the
    14·2 answers
  • The table below shows the categories of four hurricanes at various locations across Florida.
    15·1 answer
  • When examining cells in the laboratory, you notice that a particular cell has half as much DNA as the surrounding cells. This ob
    12·1 answer
  • An adult female client describes the pain in her hand as having an audible grinding and cracking sound, especially in her thumb
    5·1 answer
  • In his experiments, Griffith found that when he injected live IIR (not disease causing) bacteria with heat-killed IIIS (disease
    15·1 answer
  • A thermometer is placed in water in order to measure the water’s temperature. What would cause the liquid in the thermometer to
    11·1 answer
  • What produces the cell cycle?
    12·2 answers
  • What interventions could increase monogamy among meadow voles?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!