1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Daniel [21]
3 years ago
8

Which penguins leave and stay for winter months

Biology
2 answers:
Elden [556K]3 years ago
8 0

Emperor penguins leave and stay for winter months.

Leviafan [203]3 years ago
3 0

EMPEROR PENGUINS!

Hope this helps!

You might be interested in
4. What will be the phenotype of the fly that grows from the fertilized cell shown
erica [24]

Answer:

D

Explanation:

Take a look at the traits.

When there are two recessive alles, the recessive trait is inherited. Like in cc.

But if there is a dominate one, per say in lL, the dominant is always inherited.

3 0
3 years ago
1. What is the contour interval on this map?
alexdok [17]

Answer:

100 is the contour interval of this map

6 0
3 years ago
What is not true about the process pictured
Maurinko [17]
There is no process pictured.....
5 0
3 years ago
Who is father of biology​
olya-2409 [2.1K]
Aristotle is the father of biology
8 0
2 years ago
Read 2 more answers
What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
Kazeer [188]
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
8 0
3 years ago
Read 2 more answers
Other questions:
  • 3. Why do people need the natural world?
    5·1 answer
  • In a certain plant, yellow fruit is dominant to white fruit. A heterozygous plant with yellow fruit is crossed with a plant with
    5·1 answer
  • Plant and animal cells make exact copies through the process of
    5·2 answers
  • Which of the following steps is not likely to take place during cellular respiration?
    8·2 answers
  • Identify the three reasons cell division is important
    15·2 answers
  • Why earth is considered a closed system
    8·1 answer
  • Is it true? (The root of the tree breaks the solid rock to form soil)
    15·2 answers
  • The Earth has a magnetic field. If you were to use a bar magnet to represent the magnet causing the magnetic field, which repres
    14·2 answers
  • Ricky notices a similarity between a fried egg and the diagram of a cell, which cell organelles is Ricky likely to associate wit
    7·1 answer
  • Which level of the food web is impacted by littering plastic in Canada? and why?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!