1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
rosijanka [135]
3 years ago
14

Explain how ATP operates as a type of energy currency

Biology
1 answer:
uysha [10]3 years ago
3 0

When the ATP converts to ADP, the ATP is said to be spent. he molecule is used like a battery within cells and allows the consumption of one of its phosphorous molecules.The energy currency used by all cells from bacteria to man is adenosine triphosphate (ATP).

You might be interested in
What is an effect of adaptive radiation?
Semenov [28]
I'd have to say it'd be the dramatic increase in the diversity of the population gene pool.The increased diversity can lead, in time, to a dramatic increase in the number of distinct species in an environment.
5 0
3 years ago
Read 2 more answers
Explain the roles of and relationships among producers, consumers, and decomposers in the process of energy transfer in a food w
insens350 [35]

A producer is like grass, then consumers like a zebra will eat the grass, and wen the zebra dies its body breaks down and helps more grass grow. That cycle keeps going over and over, it never ends.

7 0
3 years ago
Read 2 more answers
Some plants are tall and some are short what is most likely true about this trait
pochemuha
Can you please show the answer choices to pick from?
7 0
3 years ago
Whales are thought to have evolved from land animals similar to large otters. as evidence of this, whales have useless leg bones
Viktor [21]
It is a vestigial structure
6 0
3 years ago
A normal cell in an adult woman has?
Assoli18 [71]

Answer:

The correct answer will be option-A.

Explanation:

The females carry two X-chromosomes in their cells but one of these X-chromosome gets permanently inactivated during embryonic development.

The X-inactivation is known as lyonization which ensures that only one functional X-chromosome should be present like in males.  This process is a random process and therefore a female can have both the functional X-chromosomes and males can also have a functional X-chromosome.

Thus, option-A is the correct answer.

3 0
3 years ago
Other questions:
  • A set of full-sibling juvenile wolf spiders was divided into two groups. One set was reared in low-temperature conditions, while
    13·1 answer
  • List tim''s symptoms and identify the organ system (or specific organ) associated with those symptoms. (your may need to referen
    15·1 answer
  • I will reward brainliest !
    6·1 answer
  • Which of the following is the best definition of empirical evidence?
    14·2 answers
  • What is the main function of the krebs cycle?
    10·2 answers
  • Do parasites live by taking nutrients from a host organism
    12·1 answer
  • How many types of cell​ ?
    13·1 answer
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
  • Manure is prepared by decomposing animal excreta and plant waste. Which of the
    14·1 answer
  • Which parts of photosynthesis occur in the thylakoid membranes of the grana?.
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!