1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
makvit [3.9K]
3 years ago
11

4.81 (a) What volume of 0.115 M HClO4 solution is needed to

Chemistry
1 answer:
neonofarm [45]3 years ago
7 0
Hahaha ?bajajsisjbwisi sosiwisos jk its so long also please make sure to stan loona and bts also stream back door by stray kids
You might be interested in
Based on the activity series of metal, which reaction with water will not happen?
laila [671]

Answer:

B

Explanation:

B, H2O + Na The elements toward the bottom left corner of the periodic table are the metals that are the most active in the sense of being the most reactive. Lithium, sodium, and potassium all react with water,

5 0
3 years ago
A 25.0g piece of aluminum sits in a room and cools. It loses 4300.0 J of heat. If the initial temperature of aluminum is 125.3°C
Vesna [10]

Answer:

-65.8C

Explanation:

8 0
3 years ago
What would be the minimum energy Emin required to excite a hydrogen atom from its lowest energy level
Wewaii [24]

The minimum energy required to excite a hydrogen atom from its lowest energy level is 10.2 eV.

<h3>What is excitation?</h3>

The term excitation has to do with the promotion of an electron from a lower to a higher energy level.

In this case, we are dealing with the hydrogen atom having only one electron. Thus, the minimum energy required to excite a hydrogen atom from its lowest energy level is 10.2 eV.

Learn more about energy level:brainly.com/question/17396431

#SPJ1

3 0
2 years ago
What is the standard value for T in the common form of the Nernst equation?
LuckyWell [14K]

C.  

52° Celsius

Hope this helped!

6 0
3 years ago
What substance can act as catalysts in the body?
pickupchik [31]

Answer:

Enzymes

Explanation:

Enzymes are proteins that can act as  catalysts in the body.

8 0
3 years ago
Other questions:
  • A machine shop worker records the mass of an aluminum cube as 176g. if one side of the cube measures 4 cm,what is the density of
    15·1 answer
  • A beaker contains 500 ml of 2.40M KNO3 the beaker is left uncovered so that all of the water evaporates. What mass of KNO3 cryst
    12·1 answer
  • What best describes why a liquid needs a container when a solid does not?
    11·2 answers
  • IS THIS A BALANCE EQUATION <br> MgCl2 + Na2O -- &gt; MgO + 2 NaCl
    12·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • An example of a solid aerosol
    11·1 answer
  • How do you calculate the number of valence electrons in an atom?
    15·1 answer
  • How many calories of heat are required to raise the temperature of 225g of water from 10.5°C to 43.7°C
    11·1 answer
  • What does pathological tissue growth mean? and add another word that means the same thing but not bigger need help pleases don't
    5·1 answer
  • In 1774, Joseph Priestly discovered oxygen gas by heating mercury(II) oxide powder with focused sunlight through a lens. How man
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!