1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Anit [1.1K]
3 years ago
9

Surrounds a plant cell, providing support

Biology
1 answer:
irga5000 [103]3 years ago
3 0

A cell wall known as cellouse.

You might be interested in
All of these examples show evidence for evolution because they show<br> and
Natali5045456 [20]

Answer:

All of these examples show evidence for evolution because they show change over time and descent from a common ancestor

3 0
3 years ago
Read 2 more answers
Scientists use experiments and observations to make
andreyandreev [35.5K]

Answer:

scientific method

Explanation:

the process used to.observe and test hypothesis

5 0
3 years ago
Read 2 more answers
Match the following terms and definitions. 1. cross-breeding; a method that unionizes gametes of differing genes to create a new
Alexus [3.1K]
<h2>Answer </h2>
  • Hybridization
  • Recombinant DNA
  • Selective Breeding

<u>Explanation</u>

1. Cross-breeding; a method that unionizes gametes of differing genes to create a new individual is hybridization. It is the idea of combining atomic orbitals into different hybrid orbitals that is proper for the pairing of electrons to create chemical bonds in valence bond as per the atomic theory.

2. Cultured DNA molecules from different biological sources is recombinant DNA. They are the molecules are DNA molecules determining by laboratory techniques of genetic recombination to take mutually genetic material from various origins.

3. A process of breeding organisms because of their specific traits is selective breeding. It is the method that grants humans practice animal breeding and plant breeding to selectively develop selective over phenotypic traits

8 0
3 years ago
Made up of individual organisms of the same species is called what
Alinara [238K]

Answer:

individual organisms of the same species living in the same geographic location at the same time makes up a population.

Explanation:

7 0
3 years ago
Indicate whether each of the following statements is true of depurination (DP), deamination (DA), or pyrimidine dimer formation
solniwko [45]

Answer:

- This process is caused by spontaneous hydrolysis of a glycosidic bond: depurination and deamination

- This process is induced by ultraviolet light:  pyrimidine dimer formation

- This can happen to guanine but not to cytosine: depurination

- This can happen to thymine but not to adenine:  pyrimidine dimer formation

- This can happen to thymine but not to cytosine: none

- Repair involves a DNA glycosylase: deamination

- Repair involves an endonuclease: depurination, deamination and  pyrimidine dimer formation

- Repair involves DNA ligase: depurination, deamination and  pyrimidine dimer formation

-  Repair depends on the existence of separate copies of the genetic information in the two strands of the double helix: depurination, deamination and  pyrimidine dimer formation

- Repair depends on cleavage of both strands of the double helix: none

Explanation:

Depurination is the loss of purine bases (either adenine or guanine), while deamination refers to the removal of an amino group. During depurination, a β-N-glycosidic bond is cleaved by hydrolysis and a nucleic base is released (either adenine or guanine). All DNA bases may undergo deamination, except thymine (since thymine does not have an amino group). The ultraviolet (UV) radiation can cause thymine or cytosine to form dimers (e.g., pyrimidine dimers), being thymine dimers the most common lesion when DNA is exposed to UV light. Pyrimidine dimers may be repaired by different excision mechanisms, e.g., nucleotide excision repair, where the recognition of the DNA damage leads to the removal of the DNA fragment containing the lesion. DNA glycosylases are enzymes involved in the mechanism of base excision, these enzymes recognize and remove damaged bases by hydrolysis of the glycosidic bond, producing an abasic (apurinic and apyrimidinic) site. A DNA ligase enzyme covalently joins two DNA molecules by forming a phosphodiester bond, which is required during these processes.

8 0
2 years ago
Other questions:
  • What are two possible uses of genetic engineering
    13·1 answer
  • Describe how desertification has impacted the environment of Latin America
    15·1 answer
  • Viruses and bacteria can infect human cells. Bacteria are living organisms, while viruses are not. How do you think the treatmen
    13·1 answer
  • How do scientists distinguish between reptiles and mammals?
    15·1 answer
  • What country sent the first man to space
    13·2 answers
  • If an invasive species that competes with foxes enters the community shown
    7·2 answers
  • (Please help this old man out)
    6·2 answers
  • A family takes its summer vacation at a beach resort. Six-year-old Timmy spends the entire morning in a swimming pool. When his
    7·1 answer
  • What plant physical structure or organ has a similar function to fish scales? Stem Stamen Bark Flower
    13·1 answer
  • 1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!