3 years ago

Jupiter has no _______, while Uranus, with a spin axis tiled 98 degrees, has the most extreme ones.

Biology

1 answer:

Kamila [148]3 years ago

6 0

Answer:

The correct answer is

Option C. Season.

Explanation:

Jupiter has no seasons, while Uranus, with a spin axis tiled 98 degrees, has the most extreme ones. Tilting of planets are responsible for season. If there is very low tilting, the seasons are not present. In jupiter the tilting is very low that is 3 degree so that's why jupiter has no seasons. In earth, the seasons are present due to high tilting i. e. 23 degree.

You might be interested in

____ are trying to create better batteries that can store more energy, so that electric cars can travel further on one charge.

Mariulka [41]

Answer is: Bret and his friends. It just makes sense

5 0

3 years ago

Read 2 more answers

First research to discover how many genes control "hair color" in dogs and fill in the number below. From your answer, explain h

jenyasd209 [6]

Answer:

Gregor Mendel's studies of heredity established the field of modern genetics. ... As you will learn, Mendel uncovered some of the rules of inheritance that scientists continue to ... Mendel created an F1 generation and observed its traits. ... Answer The allele for red eyes (R) is dominant, so all of the offspring will have red eyes.

Explanation:

3 0

3 years ago

Pago No.<br>नेपालको गणतान्त्रिक <br><br>प्रधानमन्त्र<br>को हो

Luba_88 [7]

Answer:

Great job

Explanation:

Well done!!!!!!!!!!!!!

5 0

3 years ago

Help I'm confused!

aev [14]

Answer:

TACTTCGAGAAAACCAACGAAAAGTGGTAA

Explanation:

Transcription is the process by which a strand of DNA is copied into mRNA.

Remember that in mRNA, U (Uracil) bonds with A (Adenine).

Hope that helps.

7 0

3 years ago

Which of the following statements about DNA is true?

Harrizon [31]

B is the best life ever and the worst time ever we will have a bad day of that bad day so we gotta

3 0

3 years ago

Read 2 more answers