1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mash [69]
3 years ago
6

When is superficial anatomy most useful?

Biology
1 answer:
arsen [322]3 years ago
8 0

Answer:

Superficial Anatomy is most useful for <em><u>examining the outside features of the body</u></em>.

You might be interested in
What is the message that travels to the central nervous system called?
Nataly [62]
I think its called an Axon.
7 0
3 years ago
What lipids are found in animal cell membranes?
rjkz [21]

Answer:

Phospholipids , Glycolipids , and Cholesterol

Explanation:

6 0
2 years ago
Read 2 more answers
What are two functions of the thymus gland?
lina2011 [118]
The thymus gland is the main organ of the lymphatic system. Located in the upper chest region, the primary function of this gland<span> is to promote the development of specific cells of the immune system called T lymphocytes.</span>
6 0
2 years ago
Read 2 more answers
Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi
jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0
3 years ago
1. Which type of compound is found in every DNA molecule?
Anit [1.1K]

Answer:

nucleotides

Explanation:

7 0
2 years ago
Read 2 more answers
Other questions:
  • Directly behind the frontal lobe is the _____ lobe, where sensory information registers in the _____ cortex.
    8·1 answer
  • How does water temperature affect bullfrog behavior
    6·1 answer
  • [CM.01] Two states of matter present in the water cycle are described below.
    15·2 answers
  • Explain how the process of radioactive decay is used to accurately date fossils.
    12·1 answer
  • Why is the kingdom protista considered the "junk drawer"
    6·1 answer
  • What type of membrane lines the compartments of the ventral body cavity and produces a lubricant that allows organs to move agai
    13·1 answer
  • Prior do the 1600s it was believed that all living things for either plants or animals. Which of these inventions led to the dev
    6·1 answer
  • Which cell structures are found in plant, animal and bacterial cells?​
    7·1 answer
  • Explain the relationship and importance of different levels of organization in the human body e.g. the cell, tissue, organ, orga
    11·1 answer
  • Features that have different forms (like hair or eye color)
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!