1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
devlian [24]
3 years ago
11

One negative effect of society's need for energy would include

Biology
2 answers:
Phoenix [80]3 years ago
7 0
Global warming or use of all unrenewable natural resources
Andru [333]3 years ago
6 0

Answer: Global warming

Explanation:

The need of energy can lead to global warming. people now a days are relaying more on the production of energy by burning the fossil fuels like coal, petroleum and other materials.

The need of energy is fulfilled by burning fossil fuels which releases carbon dioxide in the atmosphere which is a gas that causes global warming.

The carbon emission is increasing as the population is increasing, the need for more energy is also increasing.

You might be interested in
Merlin’s paper discusses two types of data: artifactual and paleoethnobotanical. Give specific examples of each and describe the
Neko [114]

Answer:

Merlin's paper discusses two types of data: artifactual and paleoethnobotanical. Give specific examples of each and describe the sources of data and the ...

8 0
3 years ago
Describe how actin and myosin filaments within muscle fibers produce the motile force for muscle contraction
Sidana [21]
It eats away you muscle but your body makes it better 
4 0
4 years ago
Which sense controls the position of muscles?
prohojiy [21]

Answer:

proprioception

Explanation:

Proprioception, or kinesthesia, is the sense that lets us perceive the location, movement, and action of parts of the body. It encompasses a complex of sensations, including perception of joint position and movement, muscle force, and effort.

3 0
3 years ago
What life process is affected when the integumentary system detects
Citrus2011 [14]

Thermoregulation. The integumentary system keeps body temperature within limits even when environmental temperature varies; this is called thermoregulation.

5 0
3 years ago
The charge nurse overhears two nurses talking about nursing interventions. Which statement by one of the nurses indicates that f
IRISSAK [1]

Answer:

One of the nurses can make a statement like "Mr Albert needs to see another member of the healthcare team, which is our physician"

Note: Mr Albert is the patient.

Explanation:

Nursing interventions are the treatments and actions that are performed to help a patient to reach the goals that are set for them. This intervention is decided by the nurse. The nurse uses his or her knowledge, experience and critical-thinking skills to decide which interventions will help the patient the most.

There are three types of nursing intervention:

<u>Independent</u> - Only the nurse intervenes and educates the patient.

<u>Dependent</u> - Another member of the healthcare team is required to see the patient. Eg a physician, a dentist, etc.

<u>Interdependent</u>- More than one member of the healthcare team are required to see the patient.

Further education means that other members of the healthcare team are requires to see the patient.

4 0
3 years ago
Other questions:
  • What are two plants whose stems store water?
    12·1 answer
  • Explain four treatment options for hazardous waste.
    9·2 answers
  • An experiment was conducted by Diane Dodd in which a single population of fruit flies was divided into two, with one of the popu
    6·1 answer
  • The muscle that originates on the sacrum and transverse process of each vertebra and inserts on the spinous process of the third
    13·1 answer
  • What type of natural hazard most often occurs on irrigated land as the result of poor water control
    9·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • 1 These are known as little organs
    9·2 answers
  • What is ‘Chipko Movement’
    10·1 answer
  • H.L is a 65-year-old Caucasian male diagnosed with Hodgkin’s Lymphoma (NHL) 4 months ago. He just finished receiving his third o
    14·1 answer
  • (04.02 LC)
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!