1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ElenaW [278]
3 years ago
5

– 3х + Зу = 3-5х + y = 13​

Biology
2 answers:
Goshia [24]3 years ago
8 0

Answer: (x,y) = (-17/12, 35/12)

Explanation:

kondaur [170]3 years ago
3 0

Answer: 54xy

Explanation: 54xy

You might be interested in
Two barometric pressure readings taken 12 hours apart in four North Carolina cities are shown in the table. City Air Pressure 1
mr Goodwill [35]

Answer:

help pls

Explanation:

4 0
3 years ago
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
Which of the following would cause an error in DNA replication?
oksian1 [2.3K]

Explanation:

The first option, the others are normal

7 0
3 years ago
Which form of government would have the MOST amount of citizen participation?
geniusboy [140]
ANSWER:

A. Democracy

Explanation:

A democracy would have the most amount of citizen participation because in this type of government members of society have equal access to political power through voting and elections

I hope I was helpful :)
8 0
3 years ago
Read 2 more answers
Which step in cellular respiration happens first?
liq [111]
Glycolysis. <span>This is where one 6-carbon molecule of glucose is broken down into two molecules of the three-carbon</span>
3 0
3 years ago
Read 2 more answers
Other questions:
  • What nucleic acids are only in DNA
    14·1 answer
  • Why is nitrogen fixation such an important step in the nitrogen cycle?
    7·2 answers
  • Please help! Will give Brainliest!
    13·2 answers
  • All animals
    5·1 answer
  • Compare and contrast what happens to an animal a plant and a paramecium cell in a hypotonic and isotonic and hypertonic solution
    6·1 answer
  • What is being transported along the endoplasmic reticulum
    6·1 answer
  • What is the alignment of the Earth, moon, and sun during a solar eclipse?
    12·2 answers
  • Which is the correct net ionic equation for the reaction of AgNO3 and CaCl2?
    15·1 answer
  • Please help i am giving brainliest
    15·2 answers
  • Which form of training considers the special needs of individual food handlers?.
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!