1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
VladimirAG [237]
3 years ago
15

Which of the following is the best definition of the term dependent variable?

Biology
1 answer:
lisabon 2012 [21]3 years ago
3 0

Answer:

what's measured and effected during a study.

it's named dependent because depends on it's independent variable. dependent variable is often called a response or output, because it's the response you'll get after an experiment.

You might be interested in
At the lowest biological level, groups of cells that have a similar structure and function work together as
tresset_1 [31]

Answer:

TISSUES

Explanation:

Each cell type has a special feature that enables it to perform a particular function efficiently. These cells are said to be specialized to perform specific functions. Groups of specialized cells are assembled together to form a tissue. Examples are muscle, skeletal and nervous tissues in animals as well as phloem, epidermis and xylem tissues in plants.

7 0
3 years ago
Which of the following is a testable hypothesis
Irina-Kira [14]

Answer: Crickets chirp faster when the night is warmer.

Explanation:

(apex)

4 0
4 years ago
Hershey and Chase used radioactive isotopes to label different parts of the phage. They grew one batch of phage in the presence
AlekseyPX

The sulphur would lable the capsule and the phosphorous the nucleic acid.

<h3><u>Explanation</u>:</h3>

Hershey and Chase experiment included growing of the pages in two batches, one in presence of 35S and other in presence of 32P. They then infected bacterial cells with these phages, cleaned them and then centrifuge the cells to isolate the marked elements in bacterial cells.

This was done to isolate which part of the phage is actually infective. Sulphur being a part of the proteins will mark the capsule whereas DNA having the phosphate bridges will be marked by 32P.

5 0
3 years ago
An individual with the genotype AaBb produces four different gametes in equal proportions. This is a demonstration of:_____.a. t
juin [17]

Answer: b. Mendel's law of independent assortment.

6 0
3 years ago
The extracellular matrix (ECM) was regarded decades ago as an uninteresting set of proteins and unusual carbohydrates that were
IrinaK [193]

Answer:

(a) E-cadherin growth suppressor genetic factor are significantly active space of analysis in growth and tumorigenesis. The calcium reliant connections between E-cadherin particles are essential for the creation and conservation of supporter connections in parts of animal tissue cell-cell interaction.

CAMs admire the cadherin glycoproteins ordinarily perform because the adhesive that grips cells along and performance as necessary intermediaries of cell to cell connections. E-cadherins, on the superficial of all animal tissue cells, are joined to the simple protein bodily structure complete connections with catenin’s within the protoplasm

(b) scleroprotein synthesis is exclusive assumed its closing gathering phase. justify this declaration. The last part originates from the establishment of precise amino acids admire Glycine, aminoalkanoic acid and Hydroxproline. scleroprotein additionally has 2 unusual spinoff amino acids that don't seem to be straight introduced throughout translation.

Collagen consists of three handcuffs. The manacles are looped along to create a multiple helix. the method of scleroprotein synthesis happens principally within the cells of fibroblasts that are specialised cells with the most perform of manufacturing collagen and stroma. scleroprotein mixture happens each intracellularly and extracellularly.

 

c. Laminin could be a substance of integrin’s receptors. it's AN RGD theme that dilemmas to RGD compulsory sphere on receptor. So as to investigate whether or not the somatic cell composition is because of compulsory of laminin to integrin’s, ab initio it's to be verified, that integrin’s are profusely articulated on the somatic cell semipermeable membrane. This may be achieved mistreatment technique examination via antibodies or by template RNA appearance by RT-PCR.

The appearance of those integrin’s may be inhibited mistreatment RNAi by siRNA method. The siRNA can destroy the template RNA for the integrin because it contains a balancing arrangement to the mRNA. The damage of template RNA can source decreased macromolecule appearance. The cells will then be coated on the 3 glazed plates makeshift, laminin. If the cells provide spherical cells, formerly the somatic cell composition are going to be because of integrin-laminin collaboration. The cells may be gathered and testes for somatic cell indicators that designated distinction to neuronal composition. If no diversity indicators are specificed in laminin covered plates with distorted cells as likened to the management cells that rapid integrin’s, then it's laminin integrin communication that's chargeable for the somatic cell composition see, simple protein thread designs can even be deliberate on top of things and distorted cells produce on laminin covered plates by technique.

Another technique which will be utilized is to pelt the philosophy plate with changed laminin macromolecule that absences the RGD themes. The somatic cell cell appearances will then be plated and refined on the management laminin and changed laminin missing RFD themes. If the somatic cell composition isn't ascertained, then it may be over that laminin-integrin connections are concerned in growth of the somatic cell composition.

(d) Glycosaminoglycans (GAGs) are necessary electronic warfare parts, as a result of they're extremely charged polymers that powerfully dilemma aquatic and ions, making state in electronic warfare areas, and since they dilemma and confiscate physiologically necessary proteins.

Proteoglycans facilitate control trails that management vegetative cell fate, and so represent a wonderful tool to control these trails. Although their position, there's a scarcity of knowledge linking glycosaminoglycan construction inside proteoglycans with vegetative cell variation.

7 0
3 years ago
Other questions:
  • A cross of a white hen with a black rooster produces erminette-color offspring. Which contains both black and white colors. This
    9·1 answer
  • Ways to organize data
    12·2 answers
  • What does outliers mean and can you use it in a sentence please!!!
    10·1 answer
  • Hi I need some help on these two questions
    9·1 answer
  • Drag and drop the terms on the left to complete the concept map
    15·2 answers
  • The process of splitting water to release hydrogen ions and electrons occurs during the _____ process.
    6·1 answer
  • How to answer this question in English?
    14·2 answers
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • The diagram shows the stages of the eukaryotic cell cycle.
    7·2 answers
  • Lock and key hypothesis and induced fit hypothesis​
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!